加载中

    Newcastle disease virus detection and differentiation from avian influenza. Miller Patti J,Torchetti Mia Kim Methods in molecular biology (Clifton, N.J.) Newcastle disease (ND) is a contagious and often fatal disease that affects over 250 bird species worldwide, and is caused by infection with virulent strains of avian paramyxovirus-1 (APMV-1) of the family Paramyxoviridae, genus Avulavirus. Infections of poultry with virulent strains of APMV-1 (Newcastle disease virus) are reportable to the World Organization for Animal Health (OIE). Vaccination of poultry species is a key measure in the control of ND. Other APMV-1 viruses of low virulence, which are not used as vaccines, are also often isolated from wild bird species. The APMV-1 virus, like avian influenza virus (AIV), is a hemagglutinating virus (HA) and able to agglutinate chicken red blood cells (RBC). Because the clinical presentation of ND can be difficult to distinguish from disease caused by AIV, techniques for differential diagnosis are essential, as well as the ability to detect mixed infections. When an HA positive virus is detected from virus isolation, additional assays can be performed to determine which virus is present. Both antigenic and molecular methods are necessary as some virulent ND viruses from cormorants in the USA after 2002 have lost their ability to hemagglutinate chicken RBC and molecular methods are needed for identification. 10.1007/978-1-4939-0758-8_19
    Newcastle disease virus: current status and our understanding. Ganar Ketan,Das Moushumee,Sinha Sugandha,Kumar Sachin Virus research Newcastle disease (ND) is one of the highly pathogenic viral diseases of avian species. ND is economically significant because of the huge mortality and morbidity associated with it. The disease is endemic in many third world countries where agriculture serves as the primary source of national income. Newcastle disease virus (NDV) belongs to the family Paramyxoviridae and is well characterized member among the avian paramyxovirus serotypes. In recent years, NDV has lured the virologists not only because of its pathogenic potential, but also for its oncolytic activity and its use as a vaccine vector for both humans and animals. The NDV based recombinant vaccine offers a pertinent choice for the construction of live attenuated vaccine due to its modular nature of transcription, minimum recombination frequency, and lack of DNA phase during replication. Our current understanding about the NDV biology is expanding rapidly because of the availability of modern molecular biology tools and high-throughput complete genome sequencing. 10.1016/j.virusres.2014.02.016
    Paramyxovirus glycoprotein incorporation, assembly and budding: a three way dance for infectious particle production. El Najjar Farah,Schmitt Anthony P,Dutch Rebecca Ellis Viruses Paramyxoviruses are a family of negative sense RNA viruses whose members cause serious diseases in humans, such as measles virus, mumps virus and respiratory syncytial virus; and in animals, such as Newcastle disease virus and rinderpest virus. Paramyxovirus particles form by assembly of the viral matrix protein, the ribonucleoprotein complex and the surface glycoproteins at the plasma membrane of infected cells and subsequent viral budding. Two major glycoproteins expressed on the viral envelope, the attachment protein and the fusion protein, promote attachment of the virus to host cells and subsequent virus-cell membrane fusion. Incorporation of the surface glycoproteins into infectious progeny particles requires coordinated interplay between the three viral structural components, driven primarily by the matrix protein. In this review, we discuss recent progress in understanding the contributions of the matrix protein and glycoproteins in driving paramyxovirus assembly and budding while focusing on the viral protein interactions underlying this process and the intracellular trafficking pathways for targeting viral components to assembly sites. Differences in the mechanisms of particle production among the different family members will be highlighted throughout. 10.3390/v6083019
    Innovation in Newcastle Disease Virus Vectored Avian Influenza Vaccines. Kim Shin-Hee,Samal Siba K Viruses Highly pathogenic avian influenza (HPAI) and Newcastle disease are economically important avian diseases worldwide. Effective vaccination is critical to control these diseases in poultry. Live attenuated Newcastle disease virus (NDV) vectored vaccines have been developed for bivalent vaccination against HPAI viruses and NDV. These vaccines have been generated by inserting the hemagglutinin (HA) gene of avian influenza virus into NDV genomes. In laboratory settings, several experimental NDV-vectored vaccines have protected specific pathogen-free chickens from mortality, clinical signs, and virus shedding against H5 and H7 HPAI viruses and NDV challenges. NDV-vectored H5 vaccines have been licensed for poultry vaccination in China and Mexico. Recently, an antigenically chimeric NDV vector has been generated to overcome pre-existing immunity to NDV in poultry and to provide early protection of poultry in the field. Prime immunization of one-day-old poults with a chimeric NDV vector followed by boosting with a conventional NDV vector has shown to protect broiler chickens against H5 HPAI viruses and a highly virulent NDV. This novel vaccination approach can provide efficient control of HPAI viruses in the field and facilitate poultry vaccination. 10.3390/v11030300
    Epidemiology, control, and prevention of Newcastle disease in endemic regions: Latin America. Absalón A E,Cortés-Espinosa Diana V,Lucio E,Miller P J,Afonso C L Tropical animal health and production Newcastle disease (ND) infects wild birds and poultry species worldwide, severely impacting the economics of the poultry industry. ND is especially problematic in Latin America (Mexico, Colombia, Venezuela, and Peru) where it is either endemic or re-emerging. The disease is caused by infections with one of the different strains of virulent avian Newcastle disease virus (NDV), recently renamed Avian avulavirus 1. Here, we describe the molecular epidemiology of Latin American NDVs, current control and prevention methods, including vaccines and vaccination protocols, as well as future strategies for control of ND. Because the productive, cultural, economic, social, and ecological conditions that facilitate poultry endemicity in South America are similar to those in the developing world, most of the problems and control strategies described here are applicable to other continents. 10.1007/s11250-019-01843-z
    International Biological Engagement Programs Facilitate Newcastle Disease Epidemiological Studies. Miller Patti J,Dimitrov Kiril M,Williams-Coplin Dawn,Peterson Melanie P,Pantin-Jackwood Mary J,Swayne David E,Suarez David L,Afonso Claudio L Frontiers in public health Infections of poultry species with virulent strains of Newcastle disease virus (NDV) cause Newcastle disease (ND), one of the most economically significant and devastating diseases for poultry producers worldwide. Biological engagement programs between the Southeast Poultry Research Laboratory (SEPRL) of the United States Department of Agriculture and laboratories from Russia, Pakistan, Ukraine, Kazakhstan, and Indonesia collectively have produced a better understanding of the genetic diversity and evolution of the viruses responsible for ND, which is crucial for the control of the disease. The data from Kazakhstan, Russia, and Ukraine identified possible migratory routes for birds that may carry both virulent NDV (vNDV) and NDV of low virulence into Europe. In addition, related NDV strains were isolated from wild birds in Ukraine and Nigeria, and from birds in continental USA, Alaska, Russia, and Japan, identifying wild birds as a possible mechanism of intercontinental spread of NDV of low virulence. More recently, the detection of new sub-genotypes of vNDV suggests that a new, fifth, panzootic of ND has already originated in Southeast Asia, extended to the Middle East, and is now entering into Eastern Europe. Despite expected challenges when multiple independent laboratories interact, many scientists from the collaborating countries have successfully been trained by SEPRL on molecular diagnostics, best laboratory practices, and critical biosecurity protocols, providing our partners the capacity to further train other employes and to identify locally the viruses that cause this OIE listed disease. These and other collaborations with partners in Mexico, Bulgaria, Israel, and Tanzania have allowed SEPRL scientists to engage in field studies, to elucidate more aspects of ND epidemiology in endemic countries, and to understand the challenges that the scientists and field veterinarians in these countries face on a daily basis. Finally, new viral characterization tools have been developed and are now available to the scientific community. 10.3389/fpubh.2015.00235
    The therapeutic effect of death: Newcastle disease virus and its antitumor potential. Cuadrado-Castano Sara,Sanchez-Aparicio Maria T,García-Sastre Adolfo,Villar Enrique Virus research Programmed cell death is essential to survival of multicellular organisms. Previously restricted to apoptosis, the concept of programmed cell death is now extended to other mechanisms, as programmed necrosis or necroptosis, autophagic cell death, pyroptosis and parthanatos, among others. Viruses have evolved to manipulate and take control over the programmed cell death response, and the infected cell attempts to neutralize viral infections displaying different stress signals and defensive pathways before taking the critical decision of self-destruction. Learning from viruses and their interplay with the host may help us to better understand the complexity of the self-defense death response that when altered might cause disorders as important as cancer. In addition, as the fields of immunotherapy and oncolytic viruses advance as promising novel cancer therapies, the programmed cell death response reemerges as a key point for the success of both therapeutic approaches. In this review we summarize the research of the multimodal cell death response induced by Newcastle disease viruses (NDV), considered nowadays a promising viral oncolytic therapeutic, and how the manipulation of the host programmed cell death response can enhance the NDV antitumor capacity. 10.1016/j.virusres.2015.07.001
    Temporal, geographic, and host distribution of avian paramyxovirus 1 (Newcastle disease virus). Dimitrov Kiril M,Ramey Andrew M,Qiu Xueting,Bahl Justin,Afonso Claudio L Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases Newcastle disease is caused by virulent forms of avian paramyxovirus of serotype 1 (APMV-1) and has global economic importance. The disease reached panzootic proportions within two decades after first being identified in 1926 in the United Kingdom and Indonesia and still remains endemic in many countries across the world. Here we review information on the host, temporal, and geographic distribution of APMV-1 genetic diversity based on the evolutionary systematics of the complete coding region of the fusion gene. Strains of APMV-1 are phylogenetically separated into two classes (class I and class II) and further classified into genotypes based on genetic differences. Class I viruses are genetically less diverse, generally present in wild waterfowl, and are of low virulence. Class II viruses are genetically and phenotypically more diverse, frequently isolated from poultry with occasional spillovers into wild birds, and exhibit a wider range of virulence. Waterfowl, cormorants, and pigeons are natural reservoirs of all APMV-1 pathotypes, except viscerotropic velogenic viruses for which natural reservoirs have not been identified. Genotypes I and II within class II include isolates of high and low virulence, the latter often being used as vaccines. Viruses of genotypes III and IX that emerged decades ago are now isolated rarely, but may be found in domestic and wild birds in China. Containing only virulent viruses and responsible for the majority of recent outbreaks in poultry and wild birds, viruses from genotypes V, VI, and VII, are highly mobile and have been isolated on different continents. Conversely, virulent viruses of genotypes XI (Madagascar), XIII (mainly Southwest Asia), XVI (North America) and XIV, XVII and XVIII (Africa) appear to have a more limited geographic distribution and have been isolated predominantly from poultry. 10.1016/j.meegid.2016.01.008
    [Function comparison of the matrix protein between Newcastle disease virus and other paramyxoviruses - A review] Duan Zhiqiang,Hu Shunlin,Liu Xiufan Wei sheng wu xue bao = Acta microbiologica Sinica Recent studies have found that the matrix protein of paramyxoviruses is a multifunctional viral protein. In addition to inhibiting the transcription and translation of cell genes, regulating the replication and transcription of viral genome and recruiting cellular proteins to facilitate viral assembly and budding, the matrix protein can enhance the replication of paramyxoviruses through its ubiquitination and phosphorylation. However, as a member of paramyxoviruses, the matrix protein of Newcastle disease virus (NDV) is only demonstrated to participate in viral assembly and budding. Moreover, the functions of matrix protein identified in other paramyxoviruses still remain unknown in NDV. This review compares the functions of matrix protein between NDV and other paramyxoviruses, and focuses on the relationship of matrix protein to the virulence, replication and pathogenicity of NDV. Meanwhile, challenges and research prospects of NDV matrix protein are also discussed.
    Newcastle Disease Virus as a Vaccine Vector for Development of Human and Veterinary Vaccines. Kim Shin-Hee,Samal Siba K Viruses Viral vaccine vectors have shown to be effective in inducing a robust immune response against the vaccine antigen. Newcastle disease virus (NDV), an avian paramyxovirus, is a promising vaccine vector against human and veterinary pathogens. Avirulent NDV strains LaSota and B1 have long track records of safety and efficacy. Therefore, use of these strains as vaccine vectors is highly safe in avian and non-avian species. NDV replicates efficiently in the respiratory track of the host and induces strong local and systemic immune responses against the foreign antigen. As a vaccine vector, NDV can accommodate foreign sequences with a good degree of stability and as a RNA virus, there is limited possibility for recombination with host cell DNA. Using NDV as a vaccine vector in humans offers several advantages over other viral vaccine vectors. NDV is safe in humans due to host range restriction and there is no pre-existing antibody to NDV in the human population. NDV is antigenically distinct from common human pathogens. NDV replicates to high titer in a cell line acceptable for human vaccine development. Therefore, NDV is an attractive vaccine vector for human pathogens for which vaccines are currently not available. NDV is also an attractive vaccine vector for animal pathogens. 10.3390/v8070183
    Fifty Years of Clinical Application of Newcastle Disease Virus: Time to Celebrate! Schirrmacher Volker Biomedicines This review provides an overview of 50 years of basic and clinical research on an oncolytic avian virus, Newcastle Disease Virus (NDV), which has particular anti-neoplastic and immune stimulatory properties. Of special interest is the fact that this biological agent induces immunogenic cell death and systemic anti-tumor immunity. Furthermore, localized oncolytic virotherapy with NDV was shown to overcome systemic tumor resistance to immune checkpoint blockade immunotherapy. Clinical experience attests to low side effects and a high safety profile. This is due among others to the strong virus-induced type I interferon response. Other viral characteristics are lack of interaction with host cell DNA, lack of genetic recombination and independence of virus replication from cell proliferation. In this millennium, new recombinant strains of viruses are being produced with improved therapeutic properties. Clinical applications include single case observations, case series studies and Phase I to III studies. 10.3390/biomedicines4030016
    Review of Nonfoodborne Zoonotic and Potentially Zoonotic Poultry Diseases. Agunos Agnes,Pierson F William,Lungu Bwalya,Dunn Patricia A,Tablante Nathaniel Avian diseases Emerging and re-emerging diseases are continuously diagnosed in poultry species. A few of these diseases are known to cross the species barrier, thus posing a public health risk and an economic burden. We identified and synthesized global evidence for poultry nonfoodborne zoonoses to better understand these diseases in people who were exposed to different poultry-related characteristics (e.g., occupational or nonoccupational, operational types, poultry species, outbreak conditions, health status of flocks). This review builds on current knowledge on poultry zoonoses/potentially zoonotic agents transmitted via the nonfoodborne route. It also identifies research gaps and potential intervention points within the poultry industry to reduce zoonotic transmission by using various knowledge synthesis tools such as systematic review (SR) and qualitative (descriptive) and quantitative synthesis methods (i.e., meta-analysis). Overall, 1663 abstracts were screened and 156 relevant articles were selected for further review. Full articles (in English) were retrieved and critically appraised using routine SR methods. In total, eight known zoonotic diseases were reviewed: avian influenza (AI) virus (n = 85 articles), Newcastle disease virus (n = 8), West Nile virus (WNV, n = 2), avian Chlamydia (n = 24), Erysipelothrix rhusiopathiae (n = 3), methicillin-resistant Staphylococcus aureus (MRSA, n = 15), Ornithonyssus sylvarium (n = 4), and Microsporum gallinae (n = 3). In addition, articles on other viral poultry pathogens (n = 5) and poultry respiratory allergens derived from mites and fungi (n = 7) were reviewed. The level of investigations (e.g., exposure history, risk factor, clinical disease in epidemiologically linked poultry, molecular studies) to establish zoonotic linkages varied across disease agents and across studies. Based on the multiple outcome measures captured in this review, AI virus seems to be the poultry zoonotic pathogen that may have considerable and significant public health consequences; however, epidemiologic reports have only documented severe human cases clustered in Asia and not in North America. In contrast, avian Chlamydia and MRSA reports clustered mainly in Europe and less so in North America and other regions. Knowledge gaps in other zoonoses or other agents were identified, including potential direct (i.e., nonmosquito-borne) transmission of WNV from flocks to poultry workers, the public health and clinical significance of poultry-derived (livestock-associated) MRSA, the zoonotic significance of other viruses, and the role of poultry allergens in the pathophysiology of respiratory diseases of poultry workers. Across all pathogens reviewed, the use of personal protective equipment was commonly cited as the most important preventive measure to reduce the zoonotic spread of these diseases and the use of biosecurity measures to reduce horizontal transmission in flock populations. The studies also emphasized the need for flock monitoring and an integrated approach to prevention (i.e., veterinary-public health coordination with regard to diagnosis, and knowledge translation and education in the general population) to reduce zoonotic transmission. 10.1637/11413-032416-Review.1
    Newcastle disease in Nigeria: epizootiology and current knowledge of circulating genotypes. Shittu Ismaila,Joannis Tony M,Odaibo Georgina N,Olaleye Olufemi D Virusdisease Over the years, Newcastle disease (ND) has defied all available control measures. The disease has remained at the forefront of infectious diseases afflicting poultry production after avian influenza. Despite the continuous global use of million doses of ND vaccine annually, the causative pathogen, avian paramyxovirus type 1 also known as Newcastle disease virus (NDV) has continued to evolve causing, even more, a threat not only to the unvaccinated but the vaccinated flocks inclusive. The disease has been well studied in the developed countries where the virus is found in circulation. However, limited information exists on the epizootiology and circulating genotypes of the virus in developing countries where the majority of the flocks are raised on the extensive management system. Identification of virulent NDV in apparently healthy free-range ducks in this system calls for concern and pragmatic approach to investigate factor(s) that favour the virus inhabiting the ducks without clinical manifestation of the disease. Recently, novel genotypes (XIV, XVII, and XVIII) with peculiarity to West and Central African countries have been discovered and due to lack or poor surveillance system possibility of hitherto unreported genotypes are likely. This review elucidates and discusses available literature on the diversity of the circulating NDV genotypes across the West Africa countries and the epizootiology (molecular) of the disease in Nigeria with the view of identifying gaps in knowledge that can assist in the development of effective vaccines and control strategies to combat the peril of the disease. 10.1007/s13337-016-0344-6
    Immunobiology of Newcastle Disease Virus and Its Use for Prophylactic Vaccination in Poultry and as Adjuvant for Therapeutic Vaccination in Cancer Patients. Schirrmacher Volker International journal of molecular sciences Newcastle disease (ND) is one of the most important diseases of poultry worldwide. In the last decades, molecular research has gained a lot of new information about its causative agent, (NDV). In poultry industry, certain strains of NDV have been used for preventive vaccination for more than 60 years. NDV has also been applied to cancer patients with beneficial effects for about 50 years, but this is less well known. The molecular basis for these differential effects of NDV in birds and man have been elucidated in the last decades and are explained in this review. The anti-neoplastic and immune-stimulatory properties in non-permissive hosts such as mouse and man have to do with the strong type I interferon responses induced in these foreign species. Additionally, NDV has the potential to break various types of tumor resistances and also to affect liver fibrosis. A main section is devoted to the benefits of clinical application of NDV and NDV-based vaccines to cancer patients. Reverse genetics technology allowed developing NDV into a vector suitable for gene therapy. Examples will be provided in which genetically engineered NDV is being used successfully as vector against new emerging viruses. 10.3390/ijms18051103
    Structure and organization of paramyxovirus particles. Cox Robert M,Plemper Richard K Current opinion in virology The paramyxovirus family comprises major human and animal pathogens such as measles virus (MeV), mumps virus (MuV), the parainfluenzaviruses, Newcastle disease virus (NDV), and the highly pathogenic zoonotic hendra (HeV) and nipah (NiV) viruses. Paramyxovirus particles are pleomorphic, with a lipid envelope, nonsegmented RNA genomes of negative polarity, and densely packed glycoproteins on the virion surface. A number of crystal structures of different paramyxovirus proteins and protein fragments were solved, but the available information concerning overall virion organization remains limited. However, recent studies have reported cryo-electron tomography-based reconstructions of Sendai virus (SeV), MeV, NDV, and human parainfluenza virus type 3 (HPIV3) particles and a surface assessment of NiV-derived virus-like particles (VLPs), which have yielded innovative hypotheses concerning paramyxovirus particle assembly, budding, and organization. Following a summary of the current insight into paramyxovirus virion morphology, this review will focus on discussing the implications of these particle reconstructions on the present models of paramyxovirus assembly and infection. 10.1016/j.coviro.2017.05.004
    Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines. Choi Kang-Seuk Clinical and experimental vaccine research Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. 10.7774/cevr.2017.6.2.72
    Status updates of Newcastle disease and amelioration effects of medicinal plants against Newcastle disease virus: A review. Ashraf A,Mahboob S,Andleeb R,Ijaz M U,Shah M S Acta virologica Recently, medicinal plants are achieving great interest because of their use in ethno medicine treatment of different common diseases and also other medicinal assertions are now reinforced by comprehensive scientific evidence. Almost 82 research articles and abstracts published, so far, were screened for evaluating antiviral efficiency of various plant samples and 23 different plants were found to be traditionally used against Newcastle disease (ND). ND is a most transmissible viral disease of avian species caused by virulent strain of Avula virus from the Paramyxoviridae family. The first epidemic of ND was perceived in Java, Indonesia and England in year 1926. ND causes great economic loses to the commercial poultry farmers around the world. Medicinal plants are traditionally used in the control of viral or other diseases and infections. Plants have been found useful in treating many microbial diseases in man and animals caused by bacteria and viruses. The ability to synthesize compounds retaining antiviral potential by secondary metabolism makes plants a vital source of pharmaceutical and therapeutic products, which can reduce chemotherapeutic load in birds. Current studies signify that the natural products posses a rich potential source of new antiviral compounds. Further ethnobotanical studies and laboratory investigations are established to identify species having potential to improve ND control. 10.4149/av_2018_101
    A Review of Eight High-Priority, Economically Important Viral Pathogens of Poultry within the Caribbean Region. Brown Jordan Arianne,Gongora Victor,Hartley Dane,Oura Christopher Veterinary sciences Viral pathogens cause devastating economic losses in poultry industries worldwide. The Caribbean region, which boasts some of the highest rates of poultry consumption in the world, is no exception. This review summarizes evidence for the circulation and spread of eight high-priority, economically important poultry viruses across the Caribbean region. Avian influenza virus (AIV), infectious bronchitis virus (IBV), Newcastle disease virus (NDV), infectious laryngotracheitis virus (ILTV), avian metapneumovirus (aMPV), infectious bursal disease virus (IBDV), fowl adenovirus group 1 (FADV Gp1), and egg drop syndrome virus (EDSV) were selected for review. This review of serological, molecular, and phylogenetic studies across Caribbean countries reveals evidence for sporadic outbreaks of respiratory disease caused by notifiable viral pathogens (AIV, IBV, NDV, and ILTV), as well as outbreaks of diseases caused by immunosuppressive viral pathogens (IBDV and FADV Gp1). This review highlights the need to strengthen current levels of surveillance and reporting for poultry diseases in domestic and wild bird populations across the Caribbean, as well as the need to strengthen the diagnostic capacity and capability of Caribbean national veterinary diagnostic laboratories. 10.3390/vetsci5010014
    Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms. Triosanti Lucia S,Wibowo Michael Haryadi,Widayanti Rini Veterinary world Background and Aim:Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods:The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Result:The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion:Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures. 10.14202/vetworld.2018.657-666
    Adaptation of Newcastle Disease Virus (NDV) in Feral Birds and their Potential Role in Interspecies Transmission. Rahman Aziz-Ul-,Habib Momena,Shabbir Muhammad Zubair The open virology journal Introduction:Newcastle Disease (ND), caused by Avian avulavirus 1 (AAvV 1, avulaviruses), is a notifiable disease throughout the world due to the economic impact on trading restrictions and its embargoes placed in endemic regions. The feral birds including aquatic/migratory birds and other wild birds may act as natural reservoir hosts of ND Viruses (NDVs) and may play a remarkable role in the spread of the virus in environment. In addition, other 19 avulaviruses namely: AAvV 2 to 20, have been potentially recognized from feral avian species. Expalantion:Many previous studies have investigated the field prevailing NDVs to adapt a wide range of susceptible host. Still the available data is not enough to declare the potential role of feral birds in transmission of the virus to poultry and/or other avian birds. In view of the latest evidence related to incidences of AAvVs in susceptible avian species, it is increasingly important to understand the potential of viruses to transmit within the domestic poultry and other avian hosts. Genomic and phylogenomic analysis of several investigations has shown the same (RK/RQRR↓F) motif cleavage site among NDV isolates with same genotypes from domestic poultry and other wild hosts. So, the insight of this, various semi-captive/free-ranging wild avian species could play a vital role in the dissemination of the virus, which is an important consideration to control the disease outbreaks. Insufficient data on AAvV 1 transmission from wild birds to poultry and vice versa is the main constraint to understand about its molecular biology and genomic potential to cause infection in all susceptible hosts. Conclusion:The current review details the pertinent features of several historical and contemporary aspects of NDVs and the vital role of feral birds in its molecular epidemiology and ecology. 10.2174/1874357901812010052
    Diagnostic and Vaccination Approaches for Newcastle Disease Virus in Poultry: The Current and Emerging Perspectives. Bello Muhammad Bashir,Yusoff Khatijah,Ideris Aini,Hair-Bejo Mohd,Peeters Ben P H,Omar Abdul Rahman BioMed research international Newcastle disease (ND) is one of the most devastating diseases that considerably cripple the global poultry industry. Because of its enormous socioeconomic importance and potential to rapidly spread to naïve birds in the vicinity, ND is included among the list of avian diseases that must be notified to the OIE immediately upon recognition. Currently, virus isolation followed by its serological or molecular identification is regarded as the gold standard method of ND diagnosis. However, this method is generally slow and requires specialised laboratory with biosafety containment facilities, making it of little relevance under epidemic situations where rapid diagnosis is seriously needed. Thus, molecular based diagnostics have evolved to overcome some of these difficulties, but the extensive genetic diversity of the virus ensures that isolates with mutations at the primer/probe binding sites escape detection using these assays. This diagnostic dilemma leads to the emergence of cutting-edge technologies such as next-generation sequencing (NGS) which have so far proven to be promising in terms of rapid, sensitive, and accurate recognition of virulent Newcastle disease virus (NDV) isolates even in mixed infections. As regards disease control strategies, conventional ND vaccines have stood the test of time by demonstrating track record of protective efficacy in the last 60 years. However, these vaccines are unable to block the replication and shedding of most of the currently circulating phylogenetically divergent virulent NDV isolates. Hence, rationally designed vaccines targeting the prevailing genotypes, the so-called genotype-matched vaccines, are highly needed to overcome these vaccination related challenges. Among the recently evolving technologies for the development of genotype-matched vaccines, reverse genetics-based live attenuated vaccines obviously appeared to be the most promising candidates. In this review, a comprehensive description of the current and emerging trends in the detection, identification, and control of ND in poultry are provided. The strengths and weaknesses of each of those techniques are also emphasised. 10.1155/2018/7278459
    [Progress in Newcastle disease virus against tumor]. Wang Beibei,Song Lili,Ma Dehui,Dong Yanxin,Wang Xueli Sheng wu gong cheng xue bao = Chinese journal of biotechnology Newcastle disease virus is paramyxoviridae, Avian mumps virus genus type I, and infects more than 250 species of birds, causing huge losses on poultry farming worldwide. Numerous experiments have demonstrated that Newcastle disease virus has oncolytic activity on tumor cells and can selectively replicate in cancer cells. Thus, Newcastle disease virus is a potential therapeutic agent for cancer treatment. Some human clinical trials achieved good results. In this review, we summarized research progress of the relationship between the structural protein of Newcastle disease virus and virulence, anti-tumor and autophagy of Newcastle disease. 10.13345/j.cjb.180153
    Genotype Diversity of Newcastle Disease Virus in Nigeria: Disease Control Challenges and Future Outlook. Bello Muhammad Bashir,Yusoff Khatijah Mohd,Ideris Aini,Hair-Bejo Mohd,Peeters Ben P H,Jibril Abdurrahman Hassan,Tambuwal Farouk Muhammad,Omar Abdul Rahman Advances in virology Newcastle disease (ND) is one of the most important avian diseases with considerable threat to the productivity of poultry all over the world. The disease is associated with severe respiratory, gastrointestinal, and neurological lesions in chicken leading to high mortality and several other production related losses. The aetiology of the disease is an avian paramyxovirus type-1 or Newcastle disease virus (NDV), whose isolates are serologically grouped into a single serotype but genetically classified into a total of 19 genotypes, owing to the continuous emergence and evolution of the virus. In Nigeria, molecular characterization of NDV is generally very scanty and majorly focuses on the amplification of the partial F gene for genotype assignment. However, with the introduction of the most objective NDV genotyping criteria which utilize complete fusion protein coding sequences in phylogenetic taxonomy, the enormous genetic diversity of the virus in Nigeria became very conspicuous. In this review, we examine the current ecological distribution of various NDV genotypes in Nigeria based on the available complete fusion protein nucleotide sequences (1662 bp) in the NCBI database. We then discuss the challenges of ND control as a result of the wide genetic distance between the currently circulating NDV isolates and the commonest vaccines used to combat the disease in the country. Finally, we suggest future directions in the war against the economically devastating ND in Nigeria. 10.1155/2018/6097291
    Rescue of recombinant Newcastle disease virus: current cloning strategies and RNA polymerase provision systems. Molouki Aidin,Peeters Ben Archives of virology Since the first rescue of a recombinant Newcastle disease virus (rNDV) in the late 1990s, many more rNDVs have been rescued by researchers around the world. Regardless of methodology, the main principle behind rescue of the virus has remained the same, i.e., the formation of a functional replication complex by simultaneously providing the full-length viral RNA and the viral NP, P and L proteins. However, different strategies have been reported for the insertion of the full-length genome into a suitable transcription vector, which remains the most challenging step of the rescue. Moreover, several systems have been published for provision of the DNA-dependent RNA polymerase, which is needed for transcription of viral RNA (vRNA) from the transfected plasmid DNA. The aim of this article is to consolidate all of the current cDNA assembly strategies and transcription systems used in rescue of rNDV in order to attain a better understanding of the advantages and disadvantages of each approach. 10.1007/s00705-016-3065-7
    Avian Paramyxovirus: A Brief Review. Gogoi P,Ganar K,Kumar S Transboundary and emerging diseases Avian paramyxoviruses (APMVs) have been reported from a wide variety of avian species around the world. Avian paramyxoviruses are economically significant because of the huge mortality and morbidity associated with it. Twelve different serotypes of APMV have been reported till date. Avian paramyxoviruses belong to the family Paramyxoviridae under genus Avulavirus. Newcastle disease virus (APMV-1) is the most characterized members among the APMV serotypes. Complete genome sequence of all twelve APMV serotypes has been published recently. In recent years, APMV-1 has attracted the virologists for its oncolytic activity and its use as a vaccine vector for both animals and humans. The recombinant APMV-based vaccine offers a pertinent choice for the construction of live attenuated vaccine due to its minimum recombination frequency, modular nature of transcription and lack of DNA phase during its replication. Although insufficient data are available regarding other APMV serotypes, our understanding about the APMV biology is expanding rapidly because of the availability of modern molecular biology tools and high-throughput complete genome sequencing. 10.1111/tbed.12355
    Newcastle disease vaccines-A solved problem or a continuous challenge? Dimitrov Kiril M,Afonso Claudio L,Yu Qingzhong,Miller Patti J Veterinary microbiology Newcastle disease (ND) has been defined by the World Organisation for Animal Health as infection of poultry with virulent strains of Newcastle disease virus (NDV). Lesions affecting the neurological, gastrointestinal, respiratory, and reproductive systems are most often observed. The control of ND must include strict biosecurity that prevents virulent NDV from contacting poultry, and also proper administration of efficacious vaccines. When administered correctly to healthy birds, ND vaccines formulated with NDV of low virulence or viral-vectored vaccines that express the NDV fusion protein are able to prevent clinical disease and mortality in chickens upon infection with virulent NDV. Live and inactivated vaccines have been widely used since the 1950's. Recombinant and antigenically matched vaccines have been adopted recently in some countries, and many other vaccine approaches have been only evaluated experimentally. Despite decades of research and development towards formulation of an optimal ND vaccine, improvements are still needed. Impediments to prevent outbreaks include uneven vaccine application when using mass administration techniques in larger commercial settings, the difficulties associated with vaccinating free-roaming, multi-age birds of village flocks, and difficulties maintaining the cold chain to preserve the thermo-labile antigens in the vaccines. Incomplete or improper immunization often results in the disease and death of poultry after infection with virulent NDV. Another cause of decreased vaccine efficacy is the existence of antibodies (including maternal) in birds, which can neutralize the vaccine and thereby reduce the effectiveness of ND vaccines. In this review, a historical perspective, summary of the current situation for ND and NDV strains, and a review of traditional and experimental ND vaccines are presented. 10.1016/j.vetmic.2016.12.019