Specific detection of avian influenza H5N2 whole virus particles on lateral flow strips using a pair of sandwich-type aptamers.
Kim Sang Hoon,Lee Junho,Lee Bang Hyun,Song Chang-Seon,Gu Man Bock
Biosensors & bioelectronics
We report a selection of a cognate pair of aptamers for whole avian influenza virus particles of H5N2 by using graphene-oxide based systemic evolution of ligands by exponential enrichment (GO-SELEX), and the application of a pair of sandwich-type binding aptamers on the lateral flow strips. The aptamers were characterized by GO-FRET assay, and Kd values of the selected aptamers were estimated to be from 6.913 × 10 to 1.27 × 10 EID/ml (EID/ml: 50% egg infective dose). Based on the evidence from confocal laser scanning microscope (CLSM), surface plasmon resonance (SPR), and circular dichroism (CD) spectrum analysis, the aptamers, JAPT and JHAPT, were found to be working as a cognate pair that binds to the target virus at the different sites simultaneously. This cognate pair of aptamers then was successfully applied on the lateral flow strips, clearly showing sandwich-type binding images with the presence of the certain numbers of H5N2 virus particles. On the newly developed lateral flow strips, the target virus was detectable down to 6 × 10 EID/ml in the buffer and 1.2 × 10 EID/ml in the duck's feces, respectively, by the naked eye. By using the ImageJ software, the LOD was found to be 1.27 × 10 EID/ml in the buffer and 2.09 × 10 EID/ml in the duck's feces, respectively. Interestingly, on the lateral flow strips, enhanced specificity towards the target virus (H5N2) appeared over other subtypes of H5Nx. To the best of our knowledge, this is the first report about the application of the cognate pair of aptamers for the detection of influenza virus on the lateral flow strips. This study shows the promising perspective of a cognate pair of aptamers for the on-site detection system which could be useful for rapid detection of avian influenza viruses for preventing the pandemic influenza viruses from spreading.
10.1016/j.bios.2019.03.061
Aptamers isolated against mosquito-borne pathogens.
Navien Tholasi Nadhan,Yeoh Tzi Shien,Anna Andrew,Tang Thean-Hock,Citartan Marimuthu
World journal of microbiology & biotechnology
Mosquito-borne diseases are a major threat to public health. The shortcomings of diagnostic tools, especially those that are antibody-based, have been blamed in part for the rising annual morbidity and mortality caused by these diseases. Antibodies harbor a number of disadvantages that can be clearly addressed by aptamers as the more promising molecular recognition elements. Aptamers are defined as single-stranded DNA or RNA oligonucleotides generated by SELEX that exhibit high binding affinity and specificity against a wide variety of target molecules based on their unique structural conformations. A number of aptamers were developed against mosquito-borne pathogens such as Dengue virus, Zika virus, Chikungunya virus, Plasmodium parasite, Francisella tularensis, Japanese encephalitis virus, Venezuelan equine encephalitis virus, Rift Valley fever virus and Yellow fever virus. Intrigued by these achievements, we carry out a comprehensive overview of the aptamers developed against these mosquito-borne infectious agents. Characteristics of the aptamers and their roles in diagnostic, therapeutic as well as other applications are emphasized.
10.1007/s11274-021-03097-0
Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies.
Sánchez-Luque Francisco J,Stich Michael,Manrubia Susanna,Briones Carlos,Berzal-Herranz Alfredo
Scientific reports
The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5'-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5'-CCCCGGCAAGGAGGGG-3'. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication.
10.1038/srep06242
Novel system for detecting SARS coronavirus nucleocapsid protein using an ssDNA aptamer.
Cho Seong-Je,Woo Hye-Min,Kim Ki-Sun,Oh Jong-Won,Jeong Yong-Joo
Journal of bioscience and bioengineering
The outbreak of severe acute respiratory syndrome (SARS) in 2002 affected thousands of people and an efficient diagnostic system is needed for accurate detection of SARS coronavirus (SARS CoV) to prevent or limit future outbreaks. Of the several SARS CoV structural proteins, the nucleocapsid protein has been shown to be a good diagnostic marker. In this study, an ssDNA aptamer that specifically binds to SARS CoV nucleocapsid protein was isolated from a DNA library containing 45-nuceotide random sequences in the middle of an 88mer single-stranded DNA. After twelve cycles of systematic evolution of ligands by exponential enrichment (SELEX) procedure, 15 ssDNA aptamers were identified. Enzyme-linked immunosorbent assay (ELISA) analysis was then used to identify the aptamer with the highest binding affinity to the SARS CoV nucleocapsid protein. Using this approach, an ssDNA aptamer that binds to the nucleocapsid protein with a K(d) of 4.93±0.30nM was identified. Western blot analysis further demonstrated that this ssDNA aptamer could be used to efficiently detect the SARS CoV nucleocapsid protein when compared with a nucleocapsid antibody. Therefore, we believe that the selected ssDNA aptamer may be a good alternative detection probe for the rapid and sensitive detection of SARS.
10.1016/j.jbiosc.2011.08.014
Application of Aptamers in Virus Detection and Antiviral Therapy.
Zou Xinran,Wu Jing,Gu Jiaqi,Shen Li,Mao Lingxiang
Frontiers in microbiology
Viral infections can cause serious diseases for humans and animals. Accurate and early detection of viruses is often crucial for clinical diagnosis and therapy. Aptamers are mostly single-stranded nucleotide sequences that are artificially synthesized by an technology known as the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Similar to antibodies, aptamers bind specifically to their targets. However, compared with antibody, aptamers are easy to synthesize and modify and can bind to a broad range of targets. Thus, aptamers are promising for detecting viruses and treating viral infections. In this review, we briefly introduce aptamer-based biosensors (aptasensors) and describe their applications in rapid detection of viruses and as antiviral agents in treating infections. We summarize available data about the use of aptamers to detect and inhibit viruses. Furthermore, for the first time, we list aptamers specific to different viruses that have been screened out but have not yet been used for detecting viruses or treating viral infections. Finally, we analyze barriers and developing perspectives in the application of aptamer-based virus detection and therapeutics.
10.3389/fmicb.2019.01462
Switchable aptamers for biosensing and bioseparation of viruses (SwAps-V).
Wehbe Mohamed,Labib Mahmoud,Muharemagic Darija,Zamay Anna S,Berezovski Maxim V
Biosensors & bioelectronics
There is a widespread interest in the development of aptamer-based affinity chromatographic methods for purification of biomolecules. Regardless of the many advantages exhibited by aptamers when compared to other recognition elements, the lack of an efficient regeneration technique that can be generalized to all targets has encumbered further integration of aptamers into affinity-based purification methods. Here we offer switchable aptamers (SwAps) that have been developed to solve this problem and move aptamer-based chromatography forward. SwAps are controlled-affinity aptamers, which have been employed here to purify vesicular stomatitis virus (VSV) as a model case, however this technique can be extended to all biologically significant molecules. VSV is one oncolytic virus out of an arsenal of potential candidates shown to provide selective destruction of cancer cells both in vitro and in vivo. These SwAps were developed in the presence of Ca(2+) and Mg(2+) ions where they cannot bind to their target VSV in absence of these cations. Upon addition of EDTA and EGTA, the divalent cations were sequestered from the stabilized aptameric structure causing a conformational change and subsequently release of the virus. Both flow cytometry and electrochemical impedance spectroscopy were employed to estimate the binding affinities between the selected SwAps and VSV and to determine the coefficient of switching (CoS) upon elution. Among fifteen sequenced SwAps, four have exhibited high affinity to VSV and ability to switch upon elution and thus were further integrated into streptavidin-coated magnetic beads for purification of VSV.
10.1016/j.bios.2014.08.033
Spherical Neutralizing Aptamer Inhibits SARS-CoV-2 Infection and Suppresses Mutational Escape.
Sun Miao,Liu Siwen,Song Ting,Chen Fude,Zhang Jialu,Huang Jia-Ao,Wan Shuang,Lu Yao,Chen Honglin,Tan Weihong,Song Yanling,Yang Chaoyong
Journal of the American Chemical Society
New neutralizing agents against SARS-CoV-2 and associated mutant strains are urgently needed for the treatment and prophylaxis of COVID-19. Herein, we develop a spherical cocktail neutralizing aptamer-gold nanoparticle (SNAP) to block the interaction between the receptor-binding domain (RBD) of SARS-CoV-2 and host ACE2. With the multivalent aptamer assembly as well as the steric hindrance effect of the gold scaffold, SNAP exhibits exceptional binding affinity against the RBD with a dissociation constant of 3.90 pM and potent neutralization against authentic SARS-CoV-2 with a half-maximal inhibitory concentration of 142.80 fM, about 2 or 3 orders of magnitude lower than that of the reported neutralizing aptamers and antibodies. More importantly, the synergetic blocking strategy of multivalent multisite binding and steric hindrance ensures broad neutralizing activity of SNAP, almost completely blocking the infection of three mutant pseudoviruses. Overall, the SNAP strategy provides a new direction for the development of antivirus agents against SARS-CoV-2 and other emerging coronaviruses.
10.1021/jacs.1c08226
Aptamer-based approaches for the detection of waterborne pathogens.
Vishwakarma Archana,Lal Roshni,Ramya Mohandass
International microbiology : the official journal of the Spanish Society for Microbiology
Waterborne ailments pose a serious threat to public health and are a huge economic burden. Lack of hygiene in drinking and recreational water is the chief source of microbial pathogens in developing countries. Poor water quality and sanitation account for more than 3.4 million deaths a year worldwide. This has urged authorities and researchers to explore different avenues of pathogen detection. There is a growing demand for rapid and reliable sensor technologies, in particular those that can detect in situ and perform in harsh conditions. Some of the major waterborne pathogens include Vibrio cholerae, Leptospira interrogans, Campylobacter jejuni, Shigella spp., enterotoxigenic Escherichia coli, Clostridium difficile, Cryptosporidium parvum, Entamoeba histolytica, and Hepatitis A virus. While conventional methods of pathogen detection like serodiagnosis and microbiological methods have been superseded by nucleic acid amplification methods, there is still potential for improvement. This review provides an insight into aptamers and their utility in the form of aptasensors. It discusses how aptamer-based approaches have emerged as a novel strategy and its advantages over more resource-intensive and complex biochemical approaches.
10.1007/s10123-020-00154-w
Aptamer Applications in Emerging Viral Diseases.
Krüger Arne,de Jesus Santos Ana Paula,de Sá Vanessa,Ulrich Henning,Wrenger Carsten
Pharmaceuticals (Basel, Switzerland)
Aptamers are single-stranded DNA or RNA molecules which are submitted to a process denominated SELEX. SELEX uses reiterative screening of a random oligonucleotide library to identify high-affinity binders to a chosen target, which may be a peptide, protein, or entire cells or viral particles. Aptamers can rival antibodies in target recognition, and benefit from their non-proteic nature, ease of modification, increased stability, and pharmacokinetic properties. This turns them into ideal candidates for diagnostic as well as therapeutic applications. Here, we review the recent accomplishments in the development of aptamers targeting emerging viral diseases, with emphasis on recent findings of aptamers binding to coronaviruses. We focus on aptamer development for diagnosis, including biosensors, in addition to aptamer modifications for stabilization in body fluids and tissue penetration. Such aptamers are aimed at in vivo diagnosis and treatment, such as quantification of viral load and blocking host cell invasion, virus assembly, or replication, respectively. Although there are currently no in vivo applications of aptamers in combating viral diseases, such strategies are promising for therapy development in the future.
10.3390/ph14070622
Repurposing of SARS-CoV nucleocapsid protein specific nuclease resistant RNA aptamer for therapeutics against SARS-CoV-2.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases
COVID-19 pandemic is rapidly advancing among human population. Development of new interventions including therapeutics and vaccines against SARS-CoV-2 will require time and validation before it could be made available for public use. Keeping in view of the emergent and evolving situation the motive is to repurpose and test the immediate efficacy of available drugs and therapeutics against COVID-19. Through this article we propose and discuss the possibility of repurposing the available nuclease resistant RNA aptamer against the nucleocapsid protein of SARS-CoV as a potential therapeutic agent for COVID-19.
10.1016/j.meegid.2020.104497
Detection of SARS-CoV-2 RNA Using a DNA Aptamer Mimic of Green Fluorescent Protein.
ACS chemical biology
RNA detection is important in diverse diagnostic and analytical applications. RNAs can be rapidly detected using molecular beacons, which fluoresce upon hybridizing to a target RNA but require oligonucleotides with complex fluorescent dye and quencher conjugations. Here, we describe a simplified method for rapid fluorescence detection of a target RNA using simple unmodified DNA oligonucleotides. To detect RNA, we developed Lettuce, a fluorogenic DNA aptamer that binds and activates the fluorescence of DFHBI-1T, an otherwise nonfluorescent molecule that resembles the chromophore found in green fluorescent protein. Lettuce was selected from a randomized DNA library based on binding to DFHBI-agarose. We further show that Lettuce can be split into two separate oligonucleotide components, which are nonfluorescent on their own but become fluorescent when their proximity is induced by a target RNA. We designed several pairs of split Lettuce fragments that contain an additional 15-20 nucleotides that are complementary to adjacent regions of the SARS-CoV-2 RNA, resulting in Lettuce fluorescence only in the presence of the viral RNA. Overall, these studies describe a simplified RNA detection approach using fully unmodified DNA oligonucleotides that reconstitute the Lettuce aptamer templated by RNA.
10.1021/acschembio.1c00893
Development of ssDNA Aptamers for Diagnosis and Inhibition of the Highly Pathogenic Avian Influenza Virus Subtype H5N1.
Kim Sang-Heon,Choi Jae-Woo,Kim A-Ru,Lee Sang-Choon,Yoon Moon-Young
Biomolecules
Avian influenza (AI) has severely affected the poultry industry worldwide and has caused the deaths of millions of birds. Highly pathogenic avian influenza virus is characterized by high mortality and the ability to transmit from birds to humans. Early diagnosis is difficult because of the variation in pathogenicity and the genetic diversity between virus subtypes. Therefore, development of a sensitive and accurate diagnostic system is an urgent priority. We developed ssDNA aptamer probes to detect AI viruses. Through seven rounds of SELEX to search for a probe specific to the highly pathogenic AI virus subtype H5N1, we identified 16 binding aptamers and selected two with the highest binding frequency. These two aptamers had strong binding affinities and low detection limits. We found that they could bind more specifically to H5N1, as compared to other subtypes. Furthermore, these aptamers inhibited hemagglutination, which is caused by the virus surface protein hemagglutinin. Our results indicate that our screened aptamers are effective molecular probes for diagnosing H5N1 and can be used as therapeutic agents to inhibit viral surface proteins. Sensitive diagnosis and suppression of avian influenza will help maintain a stable and healthy livestock industry, as well as protect human health.
10.3390/biom10081116
Adsorption and separation of HCV particles by novel affinity aptamer-functionalized adsorbents.
Chen Bin,Ye Qing,Zhou Kangping,Wang Yefu
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences
A novel type of aptamer-functionalized immunoadsorbent was prepared and characterized to remove HCV particles, a promising option of extracorporeal immunoadsorption (ECI) therapy against HCV. Herein, we fabricated a HCV-specific immunoadsorbent where single-stranded DNA aptamers reported and studied previously, modified with amino group at the 5' terminus, was immobilized covalently onto surfaces of carboxylated-derivative sepharose 4FF beads through N-hydroxysuccinimide (NHS) linkage. Then the adsorbents was evaluated and characterized by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Subsequently, we also confirmed that proposed immunoadsorbents exhibited a favorable biocompatibility as well as specificity. In addition, time-dependent effects of the eradication capacity of aptamer functionalized sepharose beads against HCV was investigated. With the optimized time point, the decontamination performance of HCV particles was assessed by real-time quantitative PCR (qPCR) followed by nucleic acid-based hybridization (NAH), which shows sorbents with an aptamer density of 2nmolligand/ml resin could remove approximately 80% (i.e. 8.9×10(6) HCV particles/ml resin) of the HCV genotype 2a cultivated in vitro and 75% (vary with the intial concentration of HCV from about 7.5×10(4)-4.4×10(5) HCV particles/ml resin) of the HCV samples from human plasma samples. All these results indicated that the novel aptamer-based adsorbents could effectively remove HCV particles and likely serve as a novel therapy option or at least supplementary for the treatment regimen of HCV.
10.1016/j.jchromb.2016.03.004
Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: development of a new aptamer-based assay system suitable for measuring the infectious titer of HCV.
Park Ji Hoon,Jee Min Hyeok,Kwon Oh Sung,Keum Sun Ju,Jang Sung Key
Virology
Various forms of hepatitis C virus (HCV)-related particles are produced from HCV-infected cells. Measuring infectivity of a HCV sample with the conventional 'foci counting method' is laborious and time-consuming. Moreover, the infectivity of a HCV sample does not correlate with the amount of viral RNA that can be measured by real-time RT-PCR. Here we report a new assay suitable for quantifying infectious HCV particles using aptamers against HCV E2, which is named 'Enzyme Linked Apto-Sorbent Assay (ELASA)'. The readout value of HCV ELASA linearly correlates with the infectious dose of an HCV sample, but not with the amount of HCV RNA. We also demonstrated that the activities of anti-HCV drugs can be monitored by HCV ELASA. Therefore, HCV ELASA is a quick-and-easy method to quantify infectious units of HCV stocks and to monitor efficacies of potential anti-HCV drugs.
10.1016/j.virol.2013.01.014
Development of an antigen Enzyme-Linked AptaSorbent Assay (ELASA) for the detection of swine influenza virus in field samples.
Aira Cristina,Klett-Mingo Jose Ignacio,Ruiz Tamara,Garcia-Sacristán Ana,Martín-Valls Gerard Eduard,Mateu Enric,Gómez-Laguna Jaime,Rueda Paloma,González Víctor Manuel,Rodríguez María José,López Lissette
Analytica chimica acta
Influenza viruses are highly variable pathogens that infect a wide range of mammalian and avian species. According to the internal conserved proteins (nucleoprotein: NP, and matrix proteins: M), these viruses are classified into type A, B, C, and D. Influenza A virus in swine is of significant importance to the industry since it is responsible for endemic infections that lead to high economic loses derived from poor weight gain, reproductive disorders, and the role it plays in Porcine Respiratory Disease Complex (PRDC). To date, swine influenza virus (SIV) diagnosis continues to be based in complex and expensive technologies such as RT-qPCR. In this study, we aimed to improve actual tools by the implementation of aptamers as capture molecules. First, three different aptamers have been selected using as target the recombinant NP of Influenza A virus expressed in insect cells. Then, these molecules have been used for the development of an Enzyme-Linked AptaSorbent Assay (ELASA) in combination with specific monoclonal antibodies for Influenza A detection. A total of 171 field samples (nasal swabs) have been evaluated with the newly developed assay obtaining a 79.7% and 98.1% sensitivity and specificity respectively, using real time RT-PCR as standard assay. These results suggest that the assay is a promising method that could be used for Influenza A detection in analysis laboratories facilitating surveillance labours.
10.1016/j.aca.2021.338933
A biolayer interferometry-based enzyme-linked aptamer sorbent assay for real-time and highly sensitive detection of PDGF-BB.
Gao Shunxiang,Zheng Xin,Wu Jihong
Biosensors & bioelectronics
Accurate, fast and sensitive detection of disease-specific protein biomarkers, especially in blood, urine, or other bodily fluids, is an important approach to achieve early disease diagnosis. Platelet-derived growth factor-BB (PDGF-BB), a widely used biomarker, is involved in a substantial number of serious diseases, such as hepatic fibrosis, atherosclerosis, age-related macular degeneration and diabetic eye disease and is often over-expressed in human malignant tumors. Therefore, the development of sensitive and specific detection methods for PDGF-BB is of great importance for the early diagnosis of disease and assessments of patient recovery. In the current study, a biolayer interferometry-based enzyme-linked aptamer sorbent assay (BLI-ELASA) was successfully established for rapid (20-25min), high-throughput (8 or 16 samples) and real-time monitoring of PDGF-BB in clinical samples. The method exhibited a broad detection range from 0.5 to 1000ng/mL of PDGF-BB (good linear range from 0.5 to 10ng/mL), with a low detection limit of 0.08ng/mL. Moreover, BLI-ELASA was applied to the detection of PDGF-BB in spiked serum and urine samples and showed a high degree of selectivity for PDGF-BB, good reproducibility, and stability. We believe that the methodology in this work can be easily adapted to detect other biomolecules in clinical samples, including viruses, pathogens and toxins, in a rapid, sensitive, high-throughput and real-time manner.
10.1016/j.bios.2017.11.017
Aptamer-Functionalized Nanochannels for One-Step Detection of SARS-CoV-2 in Samples from COVID-19 Patients.
Shi Liu,Wang Lin,Ma Xuemei,Fang Xiaona,Xiang Liangliang,Yi Yongxiang,Li Jinlong,Luo Zhaofeng,Li Genxi
Analytical chemistry
With the outbreak of COVID-19, which is fast transmitting and highly contagious, the development of rapid, highly specific, and sensitive detection kits has become a research hotspot. The existing assay methods for SARS-CoV-2 are mainly based on enzymatic reactions, which require expensive reagents, hindering popular use, especially in resource-constrained areas. Herein, we propose an aptamer-based method for the assay of SARS-CoV-2 via binding of the spike protein using functionalized biomimetic nanochannels. To get the analogous effect of human ACE2, a receptor for the spike protein, the aptamer to bind to the spike S1 protein has been first screened by a SELEX technique and then immobilized on the previously prepared nanochannels. In the presence of SARS-CoV-2, the changes in steric hindrance and charge density on the surface of the nanochannels will affect the ion transport, along with a rapid electrochemical response. Our method has been successfully applied to detect the viral particles in clinical pharyngeal swab specimens in one step without sample treatment. We expect this rapid, reagent-free, and sensitive assay method to be developed as a useful tool for diagnosing COVID-19.
10.1021/acs.analchem.1c04156
An adenovirus-delivered peptide aptamer C1-1 targeting the core protein of hepatitis B virus inhibits viral DNA replication and production in vitro and in vivo.
Zhang Wei,Ke Wei,Wu Si-Si,Gan Lu,Zhou Rui,Sun Chang-Yan,Long Qing-Shan,Jiang Wei,Xin Hong-Bo
Peptides
Peptide aptamers are molecules which can specifically bind to a given target protein and have the potential to selectively block the function of the target protein. It has been reported that a peptide aptamer (C1-1) identified from a randomized expression library specifically bound to the core protein of hepatitis B virus and inhibited viral capsid formation and DNA replication in vitro. Adenoviral systems are popular platforms for reliable gene delivery and high-level transient expression in any mammalian cell type in vitro, and have a natural tropism for the liver after systemic administration. In the present study, we explored the feasibility of gene therapy against HBV infection with adenoviral system, and found that systematic administration of recombinant adenovirus encoding the peptide aptamer (C1-1) significantly inhibited viral capsid formation, HBV DNA replication and virion production in vivo. These results suggest an efficient antiviral treatment against HBV infection by delivery of anti-HBV peptide aptamer with recombinant adenovirus.
10.1016/j.peptides.2009.07.006
A sandwich sensor based on imprinted polymers and aptamers for highly specific double recognition of viruses.
Chen Siyu,Luo Lianghui,Wang Lingyun,Chen Chunyan,Gong Hang,Cai Changqun
The Analyst
Highly selective and highly efficient identification of large viruses has been a major obstacle in the field of virus detection. In this work, a novel sandwich resonance light scattering sensor was designed based on molecularly imprinted polymers (MIPs) and aptamers for the first time. One of the recognition probes was obtained by molecular imprinting using environmentally friendly carbon spheres as carriers and the other by modification of the aptamer that can specifically recognize hepatitis B virus (HBV) on the surface of silicon spheres. In the presence of both probes, an MIP-HBV-aptamer sandwich structure was formed continuously in the system with the increase in HBV concentration, resulting in a strong resonance light scattering response. Finally, satisfactory selectivity and sensitivity were obtained, and the imprinting factor was as high as 7.56, which was higher than that reported in previous works of viral molecular imprinting sensor. In addition, it is of great significance to solve the problem of insufficient selectivity of traditional detection methods for macromolecular targets.
10.1039/d1an00155h
Application of the Open qPCR Instrument for the in Vitro Selection of DNA Aptamers against Epidermal Growth Factor Receptor and Drosophila C Virus.
Damase Tulsi Ram,Miura Tanya A,Parent Christine E,Allen Peter B
ACS combinatorial science
The low-cost Open qPCR instrument can be used for different tasks in the aptamer selection process: quantification of DNA, cycle course optimization, screening, and final binding characterization. We have selected aptamers against whole Drosophila C virus (DCV) particles and recombinant epidermal growth factor receptor (EGFR). We performed systematic evolution of ligands by exponential enrichment (SELEX) using the Open qPCR to optimize each amplification step. The Open qPCR instrument identified the best aptamer candidate. The Open qPCR has the capacity to perform melt curves, and we used this function to perform thermofluorimetric analysis (TFA) to quantify target-aptamer binding. We confirmed target-aptamer binding using flow cytometry. A sandwich type luminescence bioassay based on our anti-DCV aptamer was sensitive to DCV and did not respond to a related virus, demonstrating that our selected anti-DCV aptamer can be used to specifically detect DCV.
10.1021/acscombsci.7b00138
SERS imaging-based aptasensor for ultrasensitive and reproducible detection of influenza virus A.
Biosensors & bioelectronics
Surface-enhanced Raman scattering (SERS)-based aptasensors display high sensitivity for influenza A/H1N1 virus detection but improved signal reproducibility is required. Therefore, in this study, we fabricated a three-dimensional (3D) nano-popcorn plasmonic substrate using the surface energy difference between a perfluorodecanethiol (PFDT) spacer and the Au layer. This energy difference led to Au nanoparticle self-assembly; neighboring nanoparticles then created multiple hotspots on the substrate. The localized surface plasmon effects at the hot spots dramatically enhanced the incident field. Quantitative evaluation of A/H1N1 virus was achieved using the decrease of Raman peak intensity resulting from the release of Cy3-labeled aptamer DNAs from nano-popcorn substrate surfaces via the interaction between the aptamer DNA and A/H1N1 virus. The use of a Raman imaging technique involving the fast mapping of all pixel points enabled the reproducible quantification of A/H1N1 virus on nano-popcorn substrates. Average ensemble effects obtained by averaging all randomly distributed hot spots mapped on the substrate made it possible to reliably quantify target viruses. The SERS-based imaging aptasensor platform proposed in this work overcomes the issues inherent in conventional approaches (the time-consuming and labor-intensiveness of RT-PCR and low sensitivity and quantitative analysis limits of lateral flow assay kits). Our SERS-based assay for detecting A/H1N1 virus had an estimated limit of detection of 97 PFU mL (approximately three orders of magnitude more sensitive than that determined by the enzyme-linked immunosorbent assay) and the approximate assay time was estimated to be 20 min. Thus, this approach provides an ultrasensitive, reliable platform for detecting viral pathogens.
10.1016/j.bios.2020.112496
Aptamer/antibody sandwich method for digital detection of SARS-CoV2 nucleocapsid protein.
Talanta
Nucleocapsid protein (N protein) is the most abundant protein in SARS-CoV2 and is highly conserved, and there are no homologous proteins in the human body, making it an ideal biomarker for the early diagnosis of SARS-CoV2. However, early detection of clinical specimens for SARS-CoV2 remains a challenge due to false-negative results with viral RNA and host antibodies based testing. In this manuscript, a microfluidic chip with femtoliter-sized wells was fabricated for the sensitive digital detection of N protein. Briefly, β-galactosidase (β-Gal)-linked antibody/N protein/aptamer immunocomplexes were formed on magnetic beads (MBs). Afterwards, the MBs and β-Gal substrate fluorescein-di-β-d-galactopyranoside (FDG) were injected into the chip together. Each well of the chip would only hold one MB as confined by the diameter of the wells. The MBs in the wells were sealed by fluorocarbon oil, which confines the fluorescent (FL) product generated from the reaction between β-Gal and FDG in the individual femtoliter-sized well and creates a locally high concentration of the FL product. The FL images of the wells were acquired using a conventional inverted FL microscope. The number of FL wells with MBs (FL wells number) and the number of wells with MBs (MBs wells number) were counted, respectively. The percentage of FL wells was calculated by dividing (FL wells number) by (MBs wells number). The higher the percentage of FL wells, the higher the N protein concentration. The detection limit of this digital method for N protein was 33.28 pg/mL, which was 300 times lower than traditional double-antibody sandwich based enzyme-linked immunosorbent assay (ELISA).
10.1016/j.talanta.2021.122847
Ultrasensitive detection of influenza viruses with a glycan-based impedimetric biosensor.
Biosensors & bioelectronics
An ultrasensitive impedimetric glycan-based biosensor for reliable and selective detection of inactivated, but intact influenza viruses H3N2 was developed. Such glycan-based approach has a distinct advantage over antibody-based detection of influenza viruses since glycans are natural viral receptors with a possibility to selectively distinguish between potentially pathogenic influenza subtypes by the glycan-based biosensors. Build-up of the biosensor was carefully optimized with atomic force microscopy applied for visualization of the biosensor surface after binding of viruses with the topology of an individual viral particle H3N2 analyzed. The glycan biosensor could detect a glycan binding lectin with a limit of detection (LOD) of 5 aM. The biosensor was finally applied for analysis of influenza viruses H3N2 with LOD of 13 viral particles in 1 μl, what is the lowest LOD for analysis of influenza viral particles by the glycan-based device achieved so far. The biosensor could detect H3N2 viruses selectively with a sensitivity ratio of 30 over influenza viruses H7N7. The impedimetric biosensor presented here is the most sensitive glycan-based device for detection of influenza viruses and among the most sensitive antibody or aptamer based biosensor devices.
10.1016/j.bios.2015.12.102
Direct optical detection of viral nucleoprotein binding to an anti-influenza aptamer.
Negri Pierre,Chen Guojun,Kage Andreas,Nitsche Andreas,Naumann Dieter,Xu Bingqian,Dluhy Richard A
Analytical chemistry
We have demonstrated label-free optical detection of viral nucleoprotein binding to a polyvalent anti-influenza aptamer by monitoring the surface-enhanced Raman (SERS) spectra of the aptamer-nucleoprotein complex. The SERS spectra demonstrated that selective binding of the aptamer-nucleoprotein complex could be differentiated from that of the aptamer alone based solely on the direct spectral signature for the aptamer-nucleoprotein complex. Multivariate statistical methods, including principal components analysis, hierarchical clustering, and partial least squares, were used to confirm statistically significant differences between the spectra of the aptamer-nucleoprotein complex and the spectra of the unbound aptamer. Two separate negative controls were used to evaluate the specificity of binding of the viral nucleoproteins to this aptamer. In both cases, no spectral changes were observed that showed protein binding to the control surfaces, indicating a high degree of specificity for the binding of influenza viral nucleoproteins only to the influenza-specific aptamer. Statistical analysis of the spectra supports this interpretation. AFM images demonstrate morphological changes consistent with formation of the influenza aptamer-nucleoprotein complex. These results provide the first evidence for the use of aptamer-modified SERS substrates as diagnostic tools for influenza virus detection in a complex biological matrix.
10.1021/ac202427e
Evolving A RIG-I Antagonist: A Modified DNA Aptamer Mimics Viral RNA.
Journal of molecular biology
Vertebrate organisms express a diversity of protein receptors that recognize and respond to the presence of pathogenic molecules, functioning as an early warning system for infection. As a result of mutation or dysregulated metabolism, these same innate immune receptors can be inappropriately activated, leading to inflammation and disease. One of the most important receptors for detection and response to RNA viruses is called RIG-I, and dysregulation of this protein is linked with a variety of disease states. Despite its central role in inflammatory responses, antagonists for RIG-I are underdeveloped. In this study, we use invitro selection from a pool of modified DNA aptamers to create a high affinity RIG-I antagonist. A high resolution crystal structure of the complex reveals molecular mimicry between the aptamer and the 5'-triphosphate terminus of viral ligands, which bind to the same amino acids within the CTD recognition platform of the RIG-I receptor. Our study suggests a powerful, generalizable strategy for generating immunomodulatory drugs and mechanistic tool compounds.
10.1016/j.jmb.2021.167227
Enhanced growth inhibition of prostate cancer in vitro and in vivo by a recombinant adenovirus-mediated dual-aptamer modified drug delivery system.
Jing Pei,Cao Shousong,Xiao Shuangli,Zhang Xiaoqin,Ke Siyun,Ke Famin,Yu Xin,Wang Li,Wang Shurong,Luo Yuling,Zhong Zhirong
Cancer letters
The peptide aptamer DUP-1 targets prostate-specific membrane antigen (PSMA)-negative cells, while the RNA aptamer A10-3.2 targets PSMA-positive prostate cancer cells. Moreover, the tumor-suppressor gene phosphatase and tensin homolog (PTEN) and the chemotherapeutic agent doxorubicin (DOX) effectively inhibit prostate cancer, and a recombinant adenovirus (Ad5) mediates high gene transfer efficiency. Here, we design a dual-aptamer modified tumor targeting gene and DOX delivery system mediated by recombinant adenovirus (A10-3.2(DOX)/DUP-1-PEG-Ad5, ADDP-Ad5). DUP-1 and A10-3.2 are connected to the adenovirus through polyethylene glycol (PEG), PTEN is integrated into Ad5, and DOX is embedded into the double chain of aptamer A10-3.2. The PEG-modification rate of Ad5 is 98.70 ± 2.43%. The DUP-1 and A10-3.2 modified products yield 80.40 ± 1.36% and 82.20 ± 2.14%, respectively. The uptake of ADDP-Ad5 and the expression of the reporter gene are enhanced by the system in PSMA-positive LNCaP and PSMA-negative PC3 human prostate cancer cells. ADDP-Ad5 significantly inhibits the cell growth of both LNCaP and PC3 cells. More importantly, ADDP-Ad5 is active in vivo against LNCaP and PC3 tumor xenografts and exhibits no significant toxicity to the mice. Therefore, ADDP-Ad5 may have clinical potential in prostate cancer therapy.
10.1016/j.canlet.2016.10.003
Rapid and Efficient Detection of the SARS-CoV-2 Spike Protein Using an Electrochemical Aptamer-Based Sensor.
Idili Andrea,Parolo Claudio,Alvarez-Diduk Ruslán,Merkoçi Arben
ACS sensors
The availability of sensors able to rapidly detect SARS-CoV-2 directly in biological fluids in a single step would allow performing massive diagnostic testing to track in real time and contain the spread of COVID-19. Motivated by this, here, we developed an electrochemical aptamer-based (EAB) sensor able to achieve the rapid, reagentless, and quantitative measurement of the SARS-CoV-2 spike (S) protein. First, we demonstrated the ability of the selected aptamer to undergo a binding-induced conformational change in the presence of its target using fluorescence spectroscopy. Then, we engineered the aptamer to work as a bioreceptor in the EAB platform and we demonstrated its sensitivity and specificity. Finally, to demonstrate the clinical potential of the sensor, we tested it directly in biological fluids (serum and artificial saliva), achieving the rapid (minutes) and single-step detection of the S protein in its clinical range.
10.1021/acssensors.1c01222
The G-quadruplex-forming aptamer AS1411 potently inhibits HIV-1 attachment to the host cell.
Perrone Rosalba,Butovskaya Elena,Lago Sara,Garzino-Demo Alfredo,Pannecouque Christophe,Palù Giorgio,Richter Sara N
International journal of antimicrobial agents
AS1411 is a G-rich aptamer that forms a stable G-quadruplex structure and displays antineoplastic properties both in vitro and in vivo. This oligonucleotide has undergone phase 2 clinical trials. The major molecular target of AS1411 is nucleolin (NCL), a multifunctional nucleolar protein also present in the cell membrane where it selectively mediates the binding and uptake of AS1411. Cell-surface NCL has been recognised as a low-affinity co-receptor for human immunodeficiency virus type 1 (HIV-1) anchorage on target cells. Here we assessed the anti-HIV-1 properties and underlying mechanism of action of AS1411. The antiviral activity of AS1411 was determined towards different HIV-1 strains, host cells and at various times post-infection. Acutely, persistently and latently infected cells were tested, including HIV-1-infected peripheral blood mononuclear cells from a healthy donor. Mechanistic studies to exclude modes of action other than virus binding via NCL were performed. AS1411 efficiently inhibited HIV-1 attachment/entry into the host cell. The aptamer displayed antiviral activity in the absence of cytotoxicity at the tested doses, therefore displaying a wide therapeutic window and favourable selectivity indexes. These findings, besides validating cell-surface-expressed NCL as an antiviral target, open the way for the possible use of AS1411 as a new potent and promisingly safe anti-HIV-1 agent.
10.1016/j.ijantimicag.2016.01.016
Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.
Nucleic acid therapeutics
The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.
10.1089/nat.2013.0469
An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits haemagglutinin-mediated membrane fusion.
Gopinath Subash C B,Misono Tomoko S,Kawasaki Kazunori,Mizuno Takafumi,Imai Masaki,Odagiri Takato,Kumar Penmetcha K R
The Journal of general virology
Aptamers selected against various kinds of targets have shown remarkable specificity and affinity, similar to those displayed by antibodies to their antigens. To employ aptamers as genotyping reagents for the identification of pathogens and their strains, in vitro selections were carried out to find aptamers that specifically bind and distinguish the closely related human influenza A virus subtype H3N2. The selected aptamer, P30-10-16, binds specifically to the haemagglutinin (HA) region of the target strain A/Panama/2007/1999(H3N2) and failed to recognize other human influenza viruses, including another strain with the same subtype, H3N2. The aptamer displayed over 15-fold-higher affinity to the HA compared with the monoclonal antibody, and efficiently inhibited HA-mediated membrane fusion. These studies delineate the application of aptamers in the genotyping of viruses.
10.1099/vir.0.81508-0
An inhibitory RNA aptamer against the lambda cI repressor shows transcriptional activator activity in vivo.
Ohuchi Shoji,Suess Beatrix
FEBS letters
RNA aptamers are one of the promising components for constructing artificial genetic circuits. In this study, we developed a transcriptional activator based on an RNA aptamer against one of the most frequently applied repressor proteins, lambda phage cI. In vitro selection (Systematic Evolution of Ligands by EXponential enrichment) and following in vivo screening identified an RNA aptamer with the intended transcriptional activator activity from an RNA pool containing a 40-nucleotide long random region. Quantitative analysis showed a 35-fold elevation of reporter expression upon aptamer expression. These results suggest that the diversity of artificial transcriptional activators can be extended by employing RNA aptamers against repressor proteins to broaden the parts for constructing genetic circuits.
10.1002/1873-3468.12653
Specific Aptamer-Based Probe for Analyzing Biomarker MCP Entry Into Singapore Grouper Iridovirus-Infected Host Cells via Clathrin-Mediated Endocytosis.
Yu Qing,Liu Mingzhu,Wu Siting,Wei Xinxian,Xiao Hehe,Yi Yi,Cheng Hao,Wang Shaowen,Zhang Qin,Qin Qiwei,Li Pengfei
Frontiers in microbiology
Biomarkers have important roles in various physiological functions and disease pathogenesis. As a nucleocytoplasmic DNA virus, Singapore grouper iridovirus (SGIV) causes high economic losses in the mariculture industry. Aptamer-Q5-complexed major capsid protein (MCP) in the membrane of SGIV-infected cells can be used as a specific molecular probe to investigate the crucial events of MCP endocytosis into SGIV-infected host cells during viral infection. Chlorpromazine blocks clathrin-mediated endocytosis, and MCP endocytosis into SGIV-infected cells decreased significantly when the cells were pretreated with chlorpromazine. The disruption of cellular cholesterol by methyl-β-cyclodextrin also significantly reduced MCP endocytosis. In contrast, inhibitors of key regulators of caveolae/raft-dependent endocytosis and macropinocytosis, including genistein, Na/H exchanger, p21-activated kinase 1 (PAK1), myosin II, Rac1 GTPase, and protein kinase C (PKC), had no effect on MCP endocytosis. The endocytosis of the biomarker MCP is dependent on low pH and cytoskeletal actin filaments, as shown with various inhibitors (chloroquine, ammonia chloride, cytochalasin D). Therefore, MCP enters SGIV-infected host cells via clathrin-mediated endocytosis, which is dependent on dynamin, cholesterol, low pH, and cytoskeletal actin filaments. This is the first report of a specific aptamer-based probe used to analyze MCP endocytosis into SGIV-infected host cells during viral infection. This method provides a convenient strategy for exploring viral pathogenesis and facilitates the development of diagnostic tools for and therapeutic approaches to viral infection.
10.3389/fmicb.2020.01206
Three-dimensional printed magnetophoretic system for the continuous flow separation of avian influenza H5N1 viruses.
Wang Yuhe,Li Yanbin,Wang Ronghui,Wang Maohua,Lin Jianhan
Journal of separation science
As a result of the low concentration of avian influenza viruses in samples for routine screening, the separation and concentration of these viruses are vital for their sensitive detection. We present a novel three-dimensional printed magnetophoretic system for the continuous flow separation of the viruses using aptamer-modified magnetic nanoparticles, a magnetophoretic chip, a magnetic field, and a fluidic controller. The magnetic field was designed based on finite element magnetic simulation and developed using neodymium magnets with a maximum intensity of 0.65 T and a gradient of 32 T/m for dragging the nanoparticle-virus complexes. The magnetophoretic chip was designed by SOLIDWORKS and fabricated by a three-dimensional printer with a magnetophoretic channel for the continuous flow separation of the viruses using phosphate-buffered saline as carrier flow. The fluidic controller was developed using a microcontroller and peristaltic pumps to inject the carrier flow and the viruses. The trajectory of the virus-nanoparticle complexes was simulated using COMSOL for optimization of the carrier flow and the magnetic field, respectively. The results showed that the H5N1 viruses could be captured, separated, and concentrated using the proposed magnetophoretic system with the separation efficiency up to 88% in a continuous flow separation time of 2 min for a sample volume of 200 μL.
10.1002/jssc.201601379
A 2'FY-RNA Motif Defines an Aptamer for Ebolavirus Secreted Protein.
Scientific reports
With properties such as stability to long-term storage and amenability to repetitive use, nucleic acid aptamers are compatible with many sensing/transducing platforms intended for use in remote locations. Sensors with these properties are important for quickly identifying ebolavirus outbreaks, which frequently start in locations that lack sophisticated equipment. Soluble glycoprotein (sGP), an excellent biomarker for ebolaviruses, is produced from the same gene as the ebolavirus glycoprotein GP1,2 that decorates the surface of the viral particle and is secreted in abundance into the blood stream even during the early stages of infection. Here, we report the selection and properties of a 2'fluoro pyrimidine (2'FY)-modified RNA aptamer, 39SGP1A, that specifically binds sGP. We demonstrate by computational and biochemical analysis that the recognition motif of 39SGP1A is a novel polypyrimidine-rich sequence. Replacement of -F by -OH in the 2' position of the ribose resulted in complete loss of affinity for sGP. The protein motif to which the aptamer binds requires an intact sGP dimer and binds to an epitope conserved between Ebola virus (EBOV) and Sudan virus (SUDV) sGP, the most divergent Ebolavirus species. This identifies 39SGP1A as an excellent option for integration on a sensor platform to detect ebolavirus infections.
10.1038/s41598-018-30590-8
Aptamer-Based ELISA Assay for Highly Specific and Sensitive Detection of Zika NS1 Protein.
Lee Kyung Hyun,Zeng Huaqiang
Analytical chemistry
We report here a few Zika NS1-binding ssDNA aptamers selected using the conventional SELEX protocol, and their application in an ELISA assay for sensitive diagnosis of Zika NS1 protein. Among the aptamers identified, aptamers 2 and 10 could recognize different binding epitopes of Zika NS1 protein. This complementary in binding site, when coupled with an extraordinarily high binding affinity by 2 (41-nt, K = 45 pM) and high specificity by 10, was used successfully to construct an ELISA-based assay where 2 and 10 serve as the capture and detection agents, respectively, giving rise to a highly specific detection of Zika NS1 with a detection limit of 100 ng/mL in buffer. Further testing of a few in-house anti-Zika NS1 antibodies show that 2 could also pair with an anti-Zika NS1 antibody. Such aptamer-antibody pairing not only lowers the detection sensitivity by 3 orders of magnitude to 0.1 ng/mL in buffer but also enable highly sensitive detection of as low as 1 and 10 ng/mL of Zika NS1 to be carried out in 10% and 100% human serum, respectively. These results suggest that the selected aptamers would be useful for medical diagnosis of Zika virus infection in various aptamer-based diagnostic devices including ELISA assay.
10.1021/acs.analchem.7b02862
Aptamer Sandwich Assay for the Detection of SARS-CoV-2 Spike Protein Antigen.
Svobodova Marketa,Skouridou Vasso,Jauset-Rubio Miriam,Viéitez Irene,Fernández-Villar Alberto,Cabrera Alvargonzalez Jorge Julio,Poveda Eva,Bofill Clara Benavent,Sans Teresa,Bashammakh Abdulaziz,Alyoubi Abdulrahman O,O'Sullivan Ciara K
ACS omega
The novel severe acute respiratory syndrome coronavirus (SARS-CoV-2) emerged at the end of 2019, resulting in the ongoing COVID-19 pandemic. The high transmissibility of the virus and the substantial number of asymptomatic individuals have led to an exponential rise in infections worldwide, urgently requiring global containment strategies. Reverse transcription-polymerase chain reaction is the gold standard for the detection of SARS-CoV-2 infections. Antigen tests, targeting the spike (S) or nucleocapsid (N) viral proteins, are considered as complementary tools. Despite their shortcomings in terms of sensitivity and specificity, antigen tests could be deployed for the detection of potentially contagious individuals with high viral loads. In this work, we sought to develop a sandwich aptamer-based assay for the detection of the S protein of SARS-CoV-2. A detailed study on the binding properties of aptamers to the receptor-binding domain of the S protein in search of aptamer pairs forming a sandwich is presented. Screening of aptamer pairs and optimization of assay conditions led to the development of a laboratory-based sandwich assay able to detect 21 ng/mL (270 pM) of the protein with negligible cross-reactivity with the other known human coronaviruses. The detection of 375 pg of the protein in viral transport medium demonstrates the compatibility of the assay with clinical specimens. Finally, successful detection of the S antigen in nasopharyngeal swab samples collected from suspected patients further establishes the suitability of the assay for screening purposes as a complementary tool to assist in the control of the pandemic.
10.1021/acsomega.1c05521
Development and characterization of aptamer-based enzyme-linked apta-sorbent assay for the detection of Singapore grouper iridovirus infection.
Li P,Zhou L,Wei J,Yu Y,Yang M,Wei S,Qin Q
Journal of applied microbiology
AIMS:Singapore grouper iridovirus (SGIV) is a devastating aquaculture virus responsible for heavy economic losses to grouper, Epinephelus sp. aquaculture. The aim of this study was to develop a rapid and sensitive detection method for SGIV infections in infected groupers. METHODS AND RESULTS:We previously generated DNA aptamers against SGIV-infected cells. In this study, we established and characterized a novel aptamer (Q3)-based enzyme-linked apta-sorbent assay (ELASA) for the detection of SGIV infection in Epinephelus coioides. The Q3-based ELASA could detect SGIV infection rapidly in vitro and in vivo, with high specificity and stability. Q3-based ELASA specifically recognized SGIV-infected cells, but not other-virus-infected cells or uninfected cells. Q3-based ELASA detected SGIV infection in a dose-dependent manner at Q3 concentrations as low as 125 nmol l(-1) . The results in relation to SGIV-infected cells (5 × 10(4) ), incubation time (1 min) and incubation temperature (37°C) demonstrated that Q3-based ELASA could detect SGIV infection quickly and stably, superior to antibody-based enzyme-linked immunosorbent assay. Q3-based ELASA could detect the presence of SGIV infection in kidney, liver and spleen samples in vivo, at dilutions of 1/50, 1/100 and 1/50 respectively. The complete detection process took 1-2 h. CONCLUSIONS:Q3-based ELASA could be a useful tool for diagnosing SGIV infection. SIGNIFICANCE AND IMPACT OF THE STUDY:This is the first developed aptamer-based ELASA for detecting SGIV infection, and is widely applicable in grouper aquaculture industry in light of its rapidity, and high specificity and stability.
10.1111/jam.13161
A SARS-CoV-2 Spike Binding DNA Aptamer that Inhibits Pseudovirus Infection by an RBD-Independent Mechanism.
Angewandte Chemie (Weinheim an der Bergstrasse, Germany)
The receptor binding domain (RBD) of the spike glycoprotein of the coronavirus SARS-CoV-2 (CoV2-S) binds to the human angiotensin-converting enzyme 2 (ACE2) representing the initial contact point for leveraging the infection cascade. We used an automated selection process and identified an aptamer that specifically interacts with CoV2-S. The aptamer does not bind to the RBD of CoV2-S and does not block the interaction of CoV2-S with ACE2. Nevertheless, infection studies revealed potent and specific inhibition of pseudoviral infection by the aptamer. The present study opens up new vistas in developing SARS-CoV2 infection inhibitors, independent of blocking the ACE2 interaction of the virus, and harnesses aptamers as potential drug candidates and tools to disentangle hitherto inaccessible infection modalities, which is of particular interest in light of the increasing number of escape mutants that are currently being reported.
10.1002/ange.202100316
SERS-Based Biosensors for Virus Determination with Oligonucleotides as Recognition Elements.
Ambartsumyan Oganes,Gribanyov Dmitry,Kukushkin Vladimir,Kopylov Alexey,Zavyalova Elena
International journal of molecular sciences
Viral infections are among the main causes of morbidity and mortality of humans; sensitive and specific diagnostic methods for the rapid identification of viral pathogens are required. Surface-enhanced Raman spectroscopy (SERS) is one of the most promising techniques for routine analysis due to its excellent sensitivity, simple and low-cost instrumentation and minimal required sample preparation. The outstanding sensitivity of SERS is achieved due to tiny nanostructures which must be assembled before or during the analysis. As for specificity, it may be provided using recognition elements. Antibodies, complimentary nucleic acids and aptamers are the most usable recognition elements for virus identification. Here, SERS-based biosensors for virus identification with oligonucleotides as recognition elements are reviewed, and the potential of these biosensors is discussed.
10.3390/ijms21093373
Aptamer modification improves the adenoviral transduction of malignant glioma cells.
Chen Hao,Zheng Xiaojing,Di BingYan,Wang Dongyang,Zhang Yaling,Xia Haibin,Mao Qinwen
Journal of biotechnology
Adenovirus has shown increasing promise in the gene-viral therapy for glioblastoma, a treatment strategy that relies on the delivery of viruses or transgenes into tumor cells. However, targeting of adenovirus to human glioblastoma remains a challenge due to the low expression level of coxsackie and adenovirus receptor (CAR) in glioma cells. Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity to a target molecule, and are good candidates for targeted imaging and therapy. In this study, to construct an aptamer-modified Ad5, we first genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer to the modified Ad through avidin–biotin binding. The aptamers used in this study includes AS1411 and GBI-10. The former is a DNA aptamer that can bind to nucleolin, a nuclear matrix protein found on the surface of cancer cells. The latter is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. To examine if aptamer-modification of the hexon protein could improve the adenoviral transduction efficiency, a glioblastoma cell line, U251, was transduced with aptamer-modified Ads. The transduction efficiency of AS1411- or GBI-10-modified Ad was approximately 4.1-fold or 5.2-fold higher than that of the control. The data indicated that aptamer modified adenovirus would be a useful tool for cancer gene therapy.
A highly sensitive aptamer-based HIV reverse transcriptase detection assay.
DeStefano Jeffrey J,Alves Ferreira-Bravo Irani
Journal of virological methods
Although many new assays for HIV have been developed, several labs still use simple and reliable radioactivity-based reverse transcriptase (RT) nucleotide incorporation assays for detection and quantification. We describe here a new assay for detection and quantitation of HIV RT activity that is based on a high affinity DNA aptamer to RT. The aptamer is sequestered on 96-well plates where it can bind to RT and other constituents can be removed by extensive washing. Since the aptamer mimics a primer-template, upon radiolabeled nucleotide addition, bound RT molecules can extend the aptamer and the radioactive signal can be detected by standard methods. In addition to being procedurally simple, the assay demonstrated high sensitivity (detection limits for RT and virions were ≤6400 molecules (∼4 × 10 units) and ∼100-300 virions, respectively) and was essentially linear over a range of at least 10. Both wild type and drug-resistant forms of HIV-1 RT were detectable as was HIV-2 RT, although there were some modest differences in sensitivity.
10.1016/j.jviromet.2018.04.005
Rapid detection of avian influenza virus H5N1 in chicken tracheal samples using an impedance aptasensor with gold nanoparticles for signal amplification.
Karash Sardar,Wang Ronghui,Kelso Lisa,Lu Huaguang,Huang Tony Jun,Li Yanbin
Journal of virological methods
Highly pathogenic avian influenza virus H5N1 is a continuous threat to public health and poultry industry. The recurrence of the H5N1 led us to develop a robust, specific, and rapid detection method for the virus. In this study, an impedance aptasensor was developed for the virus detection using specific H5N1 aptamer and a gold interdigitated microelectrode. Streptavidin was immobilized on the microelectrode surface and biotin labeled H5N1 aptamer was bound to the immobilized streptavidin. The microelectrode was blocked with the polyethylene glycol and the bound aptamer captured the virus. The impedance change caused by the captured virus was measured using an impedance analyzer. To enhance impedance signal, a nanoparticle-based amplifier was designed and implemented by forming a network-like gold nanoparticles/H5N1-aptamer/thiocyanuric acid. The detection limit of the impedance aptasensor was 0.25 HAU for the pure virus and 1 HAU for the tracheal chicken swab samples spiked with the H5N1 virus. The detection time of aptasensor without employing the amplifier was less than an hour. The amplifier increased impedance by a 57-fold for the 1 HAU samples. Only negligible impedance change was observed for non-target viruses such as H5N2, H5N3, H7N2, H1N1, and H2N2. This aptasensor provides a foundation for the development of a portable aptasensor instrument.
10.1016/j.jviromet.2016.07.018
Lighting up ATP in cells and tissues using a simple aptamer-based fluorescent probe.
Liu Wenjun,Zhu Xuena,Mozneb Maedeh,Nagahara Larry,Hu Tony Y,Li Chen-Zhong
Mikrochimica acta
Extracellular ATP as a purinergic signaling molecule, together with ATP receptor, are playing an important role in tumor growth, therapy resistance, and host immunity suppression. Meanwhile ATP is a crucial indicator for cellular energy status and viability, thus a vital variable for tissue regeneration and in vitro tissue engineering. Most recent studies on COVID-19 virus suggest infection caused ATP deficit and release as a major characterization at the early stage of the disease and major causes for disease complications. Thus, imaging ATP molecule in both cellular and extracellular contexts has many applications in biology, engineering, and clinics. A sensitive and selective fluorescence "signal-on" probe for ATP detection was constructed, based on the base recognition between a black hole quencher (BHQ)-labeled aptamer oligonucleotide and a fluorophore (Cy5)-labeled reporter flare. The probe was able to detect ATP in solution with single digit µM detection limit. With the assistance of lipofectamine, this probe efficiently entered and shined in the model cells U2OS within 3 h. Further application of the probe in specific scenery, cardio-tissue engineering, was also tested where the ATP aptamer complex was able to sense cellular ATP status in a semi-quantitative manner, representing a novel approach for selection of functional cardiomyocytes for tissue engineering. At last a slight change in probe configuration in which a flexible intermolecular A14 linker was introduced granted regeneration capability. These data support the application of this probe in multiple circumstances where ATP measurement or imaging is on demand.
10.1007/s00604-021-05012-8
Aptamers that bind to the hemagglutinin of the recent pandemic influenza virus H1N1 and efficiently inhibit agglutination.
Gopinath Subash C B,Kumar Penmetcha K R
Acta biomaterialia
Influenza virus hemagglutinin (HA) mediates both receptor (glycan) binding and membrane fusion for cell entry and has been the basis for typing influenza A viruses. In this study we have selected RNA aptamers (D-12 and D-26) that specifically target the HA protein of the recent pandemic influenza virus pdmH1N1 (A/California/07/2009). Among the selected aptamers the D-26 aptamer showed higher affinity for the HA of pdmH1N1 and was able to distinguish HA derived from other sub-types of influenza A viruses. The affinity of the D-26 aptamer was further improved upon incorporation of 2'-fluoropyrimidines to a level of 67 fM. Furthermore, the high affinity D-12 and D-26 aptamers were tested for their ability to interfere with HA-glycan interactions using a chicken red blood cell (RBC) agglutination assay. At a concentration of 200 nM the D-26 aptamer completely abolished the agglutination of RBCs, whereas D-12 only did so at 400 nM. These studies suggest that the selected aptamer D-26 not only has a higher affinity and specificity for the HA of pdmH1N1 but also has a better ability to efficiently interfere with HA-glycan interactions compared with the D-12 aptamer. The D-26 aptamer warrants further study regarding its application in developing topical virucidal products against the pdmH1N1 virus and also in surveillance of the pdmH1N1 influenza virus.
10.1016/j.actbio.2013.06.016
Consensus Receptor-Binding Domain-Targeted Aptamer Selection and Designing of a Photonic Crystal-Decorated Aptasensor for SARS-CoV-2.
Analytical chemistry
The frequent emergence of variants of concern (VOC) of SARS-CoV-2 necessitates a sensitive and all-inclusive detection platform that remains viable despite the virus mutations. In this context, we targeted the receptor-binding domain (RBD) of glycoprotein (S-protein) of all VOC and constructed a consensus RBD (cRBD) based on the conserved amino acids. Then, we selected a high-affinity ssDNA novel aptamer specific for the cRBD by an in silico approach. The selected aptamer is utilized to fabricate a photonic crystal (PC)-decorated aptasensor (APC-sensor), which consists of polystyrene nanoparticles polymerized within a polyacrylamide hydrogel. cRBD-responsive ssDNA aptamers are crosslinked in the hydrogel network, which selectively bind to the cRBD and SARS-CoV-2 in saliva samples. The binding response can be visually monitored by swelling of the hydrogel and color generation by diffraction of light from PCs and can be quantified by the diffraction ring diameter or a spectrometer. The sensor delivers a LOD of 12.7 ± 0.55 ng mL for the cRBD and 3 ± 18.8 cells mL for SARS-CoV-2 in saliva samples, with a rapid response of 5 min. The sensor can be stored and regenerated without loss of activity. It can be utilized as a point-of-care testing (POCT) for SARS-CoV-2 diagnosis.
10.1021/acs.analchem.2c00937
Aptamer-gold nanoparticle conjugates for the colorimetric detection of arboviruses and vector mosquito species.
RSC advances
The real-time, colorimetric detection of analytes aptamer-gold nanoparticle technology has proven to be an important, emerging technique within the medical field. Of global health importance, the ability to detect vector mosquito species, such as the () mosquito, and transmitted arboviruses, such as Zika virus, is paramount to mosquito control and surveillance efforts. Herein, we describe the detection of salivary protein for vector identification and the detection of Zika virus to assess mosquito infection status by aptamer-gold nanoparticle conjugates. Key to optimization of these diagnostics were gold nanoparticle capping agents and aptamer degree of labelling (, the amount of aptamers per gold nanoparticle). In the present study, detection was achieved for as little as 10 ng salivary protein and 1.0 × 10 PFU live Zika virus. These aptamer-gold nanoparticle conjugate diagnostics could one day prove to be useful as deployable nano-based biosensors that provide easy-to-read optical read outs through a straightforward red-to-blue colour change either within a diagnostic solution or atop a card/membrane-based biosensor.
10.1039/c9ra02089f
Development and Characterization of an HPV Type-16 Specific Modified DNA Aptamer for the Improvement of Potency Assays.
Trausch Jeremiah J,Shank-Retzlaff Mary,Verch Thorsten
Analytical chemistry
Measuring vaccine potency is critical for vaccine release and is often accomplished using antibody-based ELISAs. Antibodies can be associated with significant drawbacks that are often overlooked including lot-to-lot variability, problems with cell-line maintenance, limited stability, high cost, and long discovery lead times. Here, we address many of these issues through the development of an aptamer, known as a slow off-rate modified DNA aptamer (SOMAmer), which targets a vaccine antigen in the human papillomavirus (HPV) vaccine Gardasil. The aptamer, termed HPV-07, was selected to bind the Type 16 virus-like-particle (VLP) formed by the self-assembling capsid protein L1. It is capable of binding with high sensitivity (EC of 0.1 to 0.4 μg/mL depending on assay format) while strongly discriminating against other VLP types. The aptamer competes for binding with the neutralizing antibody H16.V5, indicating at least partial recognition of a neutralizing and clinically relevant epitope. This makes it a useful reagent for measuring both potency and stability. When used in an ELISA format, the aptamer displays both high precision (intermediate precision of 6.3%) and a large linear range spanning from 25% to 200% of a typical formulation. To further exploit the advantages of aptamers, a simplified mix and read assay was also developed. This assay format offers significant time and resource reductions compared to a traditional ELISA. These results show aptamers are suitable reagents for biological potency assays, and we expect that their implementation could improve upon current assay formats.
10.1021/acs.analchem.6b04852
Aptamers: The Powerful Molecular Tools for Virus Detection.
Han Cong,Li Qian,Ji Haishuo,Xing Wenping,Zhang Limin,Zhang Liyun
Chemistry, an Asian journal
Aptamers are short single-stranded DNA or RNA oligonucleotides selected by the technique of systematic evolution of ligands by exponential enrichment (SELEX). Aptamers have been demonstrated to bind various targets from small-molecule to cells or even tissues in the way of antibodies. Thus, they are called chemical antibodies. We summarize and evaluate recent developments in aptamer-based sensors (for short aptasensors) for virus detection in this review. These aptasensors are mainly classified into optical and electronic aptasensors based on the type of transducer. Nowadays, the smartphone has become the most widely used mobile device with billions of users worldwide. Considering the ongoing COVID-19 outbreak, smartphone-based aptasensors for a portable and point-of-care test (POCT) of COVID-19 detection will be of great importance in the future.
10.1002/asia.202100242
Highly sensitive sandwich-type SPR based detection of whole H5Nx viruses using a pair of aptamers.
Nguyen Van-Thuan,Seo Ho Bin,Kim Byoung Chan,Kim Sang Kyung,Song Chang-Seon,Gu Man Bock
Biosensors & bioelectronics
In this research, we report highly sensitive and specific sandwich-type SPR-based biosensor for the detection H5Nx whole viruses. A few of aptamers, for the first time, were successfully screened and characterized for whole avian influenza (AI) viruses, H5Nx, by using Multi-GO-SELEX method. The affinities of the aptamers developed in this study were ranged from 8×10(4) to 1×10(4)EID50/ml, and the aptamers IF22, IF23 were found to be specific to H5N1 and H5N8, respectively. In addition, some flexible aptamers IF20, IF15, and IF10 were found to bind to the H5N1 and H5N2, H5N1 and H5N8, or H5N1, H5N2, and H5N8, respectively. Moreover, aptamers IF10 and IF22 were found to bind H5N1 virus simultaneously and confirmed to bind the different site of the same H5N1 whole virus. Therefore, this pair of aptamers, IF10 and IF22, were successfully applied to develop the sandwich-type SPR-based biosensor assay which is rapid, accurate for the detection of AI whole virus from H5N1-infected feces samples. The minimum detectible concentration of H5N1 whole virus was found to be 200 EID50/ml with this sandwich-type detection using the aptamer pair obtained in this study. In addition, the sensitivity of this biosensor was successfully enhanced by using the signal amplification with the secondary aptamer conjugated with gold nanoparticles.
10.1016/j.bios.2016.06.064
Impedimetric Aptamer-Based Biosensors: Applications.
Preuß John-Alexander,Reich Peggy,Bahner Nicole,Bahnemann Janina
Advances in biochemical engineering/biotechnology
Impedimetric aptamer-based biosensors show high potential for handheld devices and point-of-care tests. In this review, we report on recent advances in aptamer-based impedimetric biosensors for applications in biotechnology. We detail on analytes relevant in medical and environmental biotechnology as well as food control, for which aptamer-based impedimetric biosensors were developed. The reviewed biosensors are examined for their performance, including sensitivity, selectivity, response time, and real sample validation. Additionally, the benefits and challenges of impedimetric aptasensors are summarized.
10.1007/10_2020_125
Isolation of Endogenously Assembled RNA-Protein Complexes Using Affinity Purification Based on Streptavidin Aptamer S1.
Dong Yangchao,Yang Jing,Ye Wei,Wang Yuan,Ye Chuantao,Weng Daihui,Gao Huan,Zhang Fanglin,Xu Zhikai,Lei Yingfeng
International journal of molecular sciences
Efficient isolation of endogenously assembled viral RNA-protein complexes is essential for understanding virus replication mechanisms. We have developed an affinity purification strategy based on an RNA affinity tag that allows large-scale preparation of native viral RNA-binding proteins (RBPs). The streptavidin-binding aptamer S1 sequence was inserted into the 3' end of dengue virus (DENV) 5'-3' UTR RNA, and the DENV RNA UTR fused to the S1 RNA aptamer was expressed in living mammalian cells. This allowed endogenous viral ribonucleoprotein (RNP) assembly and isolation of RNPs from whole cell extract, through binding the S1 aptamer to streptavidin magnetic beads. Several novel host DENV RBPs were subsequently identified by liquid chromatography with tandem mass spectrometry (LC-MS/MS), including RPS8, which we further implicate in DENV replication. We proposed efficient S1 aptamer-based isolation of viral assembled RNPs from living mammalian cells will be generally applicable to the purification of high- and low-affinity RBPs and RNPs under endogenous conditions.
10.3390/ijms160922456
Aptamer-based biosensors and their implications in COVID-19 diagnosis.
Mandal Mukti,Dutta Nirmita,Dutta Gorachand
Analytical methods : advancing methods and applications
Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), a novel infectious member of the coronavirus family, has caused millions of cases of infection and deaths all over the world, and been declared a pandemic by the World Health Organization. Conventional laboratory-based diagnostic testing has faced extreme difficulties in meeting the overwhelming demand for testing worldwide, and this has brought about a pressing need for cost-effective rapid diagnosis. There has been a surge in the number of prototypes of diagnostic kits developed, although many of these have been found to be lacking in terms of their accuracy and sensitivity. One type of chip-based diagnostic platform is the aptamer-based biosensor. Aptamers are artificially synthesized oligonucleotides that are capable of specifically binding to a target antigen. As of now, some aptamers have been reported for SARS-CoV-2. Although many ultrasensitive aptasensors have been developed for viruses, few have been successfully adapted for SARS-CoV-2 detection. Our review discusses the recent developments in the domain of SARS-CoV-2 specific aptamer isolation, the design of electrochemical and optical aptasensors, and the implications of aptasensor-based COVID-19 diagnosis.
10.1039/d1ay01519b
Structure of HIV-1 reverse transcriptase bound to a novel 38-mer hairpin template-primer DNA aptamer.
Miller Matthew T,Tuske Steve,Das Kalyan,DeStefano Jeffrey J,Arnold Eddy
Protein science : a publication of the Protein Society
The development of a modified DNA aptamer that binds HIV-1 reverse transcriptase (RT) with ultra-high affinity has enabled the X-ray structure determination of an HIV-1 RT-DNA complex to 2.3 Å resolution without the need for an antibody Fab fragment or RT-DNA cross-linking. The 38-mer hairpin-DNA aptamer has a 15 base-pair duplex, a three-deoxythymidine hairpin loop, and a five-nucleotide 5'-overhang. The aptamer binds RT in a template-primer configuration with the 3'-end positioned at the polymerase active site and has 2'-O-methyl modifications at the second and fourth duplex template nucleotides that interact with the p66 fingers and palm subdomains. This structure represents the highest resolution RT-nucleic acid structure to date. The RT-aptamer complex is catalytically active and can serve as a platform for studying fundamental RT mechanisms and for development of anti-HIV inhibitors through fragment screening and other approaches. Additionally, the structure allows for a detailed look at a unique aptamer design and provides the molecular basis for its remarkably high affinity for RT.
10.1002/pro.2776
An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.
Moore Matthew D,Escudero-Abarca Blanca I,Jaykus Lee-Ann
Methods in molecular biology (Clifton, N.J.)
Nucleic acid aptamers are a class of alternative ligands increasingly growing in importance in the face of contemporary detection challenges. Aptamers offer multiple advantages over traditional ligands like antibodies; however, their ability to specifically bind target molecules must first be confirmed after their generation. Use of a plate-based enzyme-linked aptamer sorbent assay (ELASA) is a generally rapid way to screen and characterize aptamer binding to protein targets. ELASA involves directly plating a protein target onto a nonspecific (polystyrene) surface and assessing binding of functionalized (biotinylated) aptamers to those plated proteins using an enzyme conjugate that recognizes the aptamers. Here, we describe an ELASA that was designed and used to evaluate and compare binding of ssDNA aptamers against the capsids of different strains of human norovirus.
10.1007/978-1-4939-6857-2_18
Development and evaluation of a novel in situ target-capture approach for aptamer selection of human noroviruses.
Liu Danlei,Zhang Zilei,Yin Yujie,Jia Feng,Wu Qingping,Tian Peng,Wang Dapeng
Talanta
Human noroviruses (HuNoVs) is the primary non-bacterial pathogen causing acute gastroenteritis worldwide. Molecular approaches have been mainly used for detection of HuNoVs. Aptamer-based assay has been also applied for detection of HuNoVs through affinity binding of viral capsid. In a conventional systematic evolution of ligands by exponential enrichment process, the target protein-bound sequences in the library were recovered by complicated process including affinity chromatography, extraction, membrane-filtration or antibody-conjugated magnetic beads. In this study, a novel approach was applied to select aptamers for HuNoVs. The new approach incorporated an in situ capture assay and next generation sequencing (NSG) for selecting the aptamers. P particles of HuNoV (GII.4) were purified and coated on the module to capture sequences that were specifically bound with the protein. The unbound sequences were easily removed by washing. The sequences with high affinity were amplified just in the wells and selected by repeated in situ selection process. From the total of 30,622,226 tested sequences, two aptamers, APTL-1 and APTL-6, were finally selected to incorporate with in situ capture RT-qPCR assay for detection of HuNoVs from clinical samples. The sensitivity of these two aptamers was compared with porcine gastric mucin (PGM) that contains well-known viral receptors, and the reported aptamer APT-M6-2. Both GI and GII HuNoVs could be detected from 5 clinical samples tested. The selected aptamer APTL-1 was comparable to PGM and slightly superior to the reported APTM6-2 aptamer for detection of HuNoVs from clinical samples. The results demonstrated that this in situ target-capture approach for aptamer selection is practicable.
10.1016/j.talanta.2018.09.084
Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex.
Biochemical and biophysical research communications
93del is a 16-nucleotide G-quadruplex-forming aptamer which can inhibit the activity of the HIV-1 integrase enzyme at nanomolar concentration. Previous structural analyses of 93del using NMR spectroscopy have shown that the aptamer forms an interlocked G-quadruplex structure in K solution. Due to its exceptional stability and unique topology, 93del has been used in many different studies involving DNA G-quadruplexes, such as DNA aptamer and multimer design, as well as DNA fluorescence research. To gain further insights on the structure of this unique aptamer, we have determined several high-resolution crystal structures of 93del and its variants. While confirming the overall dimeric interlocked G-quadruplex folding topology previously determined by NMR, our results reveal important detailed structural information, particularly the formation of a water-mediated A•G•G•G•G pentad. These insights allow us to better understand the formation of various structural elements in G-quadruplexes and should be useful for designing and manipulating G-quadruplex scaffolds with desired properties.
10.1016/j.bbrc.2022.04.020
A TIM-3 Oligonucleotide Aptamer Enhances T Cell Functions and Potentiates Tumor Immunity in Mice.
Gefen Tal,Castro Iris,Muharemagic Darija,Puplampu-Dove Yvonne,Patel Shradha,Gilboa Eli
Molecular therapy : the journal of the American Society of Gene Therapy
T cell immunoglobulin-3 (TIM-3) is a negative regulator of interferon-γ (IFN-γ) secreting CD4 T cells and CD8 T cytotoxic cells. Recent studies have highlighted the role of TIM-3 as an important mediator of CD8 T cell exhaustion in the setting of chronic viral infections and cancer. In murine tumor models, antibody blockade of TIM-3 with anti-TIM-3 antibodies as monotherapy has no or minimal antitumor activity, suggesting that TIM-3 signaling exerts an accessory or amplifying effect in keeping immune responses in check. Using a combined bead and cell-based systemic evolution of ligands by exponential enrichment (SELEX) protocol, we have isolated nuclease-resistant oligonucleotide aptamer ligands that bind to cell-associated TIM-3 with high affinity and specificity. A trimeric form of the TIM-3 aptamer blocked the interaction of TIM-3 with Galectin-9, reduced cell death, and enhanced survival, proliferation, and cytokine secretion in vitro. In tumor-bearing mice, the aptamer delayed tumor growth as monotherapy and synergized with PD-1 antibody in prolonging the survival of the tumor-bearing mice. Both in vitro and in vivo, the trimeric aptamer displayed superior activity compared to the currently used RMT3-23 monoclonal antibody. This study suggests that multi-valent aptamers could represent an alternative platform to generate potent ligands to manipulate the function of TIM-3 and other immune modulatory receptors.
10.1016/j.ymthe.2017.06.023
Visualization of cell-type dependent effects of anti-E2 antibody and interferon-gamma treatments on localization and expression of Broccoli aptamer-tagged alphavirus RNAs.
Scientific reports
Sindbis virus (SINV) is an alphavirus that causes age-dependent encephalomyelitis in mice. Within 7-8 days after infection infectious virus is cleared from neurons through the antiviral effects of antibody and interferon-gamma (IFNγ), but RNA persists. To better understand changes in viral RNA associated with immune-mediated clearance we developed recombinant strains of SINV that have genomic and subgenomic viral RNAs tagged with the Broccoli RNA aptamer that binds and activates a conditional fluorophore for live cell imaging of RNA. Treatment of SINV-Broccoli-infected cells with antibody to the SINV E2 glycoprotein had cell type-specific effects. In BHK cells, antibody increased levels of intracellular viral RNA and changed the primary location of genomic RNA from the perinuclear region to the plasma membrane without improving cell viability. In undifferentiated and differentiated AP7 (dAP7) neuronal cells, antibody treatment decreased levels of viral RNA. Occasional dAP7 cells escaped antibody-mediated clearance by not expressing cell surface E2 or binding antibody to the plasma membrane. IFNγ decreased viral RNA levels only in dAP7 cells and synergized with antibody for RNA clearance and improved cell survival. Therefore, analysis of aptamer-tagged SINV RNAs identified cell type- and neuronal maturation-dependent responses to immune mediators of virus clearance.
10.1038/s41598-020-61015-0
Inhibition of Human Papillomavirus Type 16 Infection Using an RNA Aptamer.
Valencia-Reséndiz Diana Gabriela,Palomino-Vizcaino Giovanni,Tapia-Vieyra Juana Virginia,Benítez-Hess María Luisa,Leija-Montoya Ana Gabriela,Alvarez-Salas Luis Marat
Nucleic acid therapeutics
Human papillomavirus type 16 (HPV16) DNA has been found in ∼50% of cervical tumors worldwide. HPV infection starts with the binding of the virus capsid to heparan sulfate (HS) receptors exposed on the surface of epithelial basal layer keratinocytes. Previously, our group isolated a high-affinity RNA aptamer (Sc5c3) specific for HPV16 L1 virus-like particles (VLPs). In this study, we report the inhibition of HPV16 infection by Sc5c3 in a pseudovirus (PsVs) model. 293TT cells were infected by HPV16 PsVs containing the yellow fluorescent protein (YFP) as reporter gene. Incubation of HPV16 PsVs with Sc5c3 before infection resulted in a dose-dependent decrease in YFP fluorescence, suggesting infection inhibition. Aptamer degradation by RNase A restored PsVs infectivity, supporting the previous observation that Sc5c3 aptamer can inhibit infection. VLP mutants with removed HS binding sites were used in binding assays to elucidate the Sc5c3 blocking mechanism; however, no binding difference was observed between wild-type and mutant VLPs, suggesting that pseudoinfection inhibition relies on mechanisms additional to electrostatic HS binding site interaction. A DNA/RNA Sc5c3 version also inhibited HPV PsVs infection, suggesting that a modified, nuclease-resistant Sc5c3 may be used to inhibit HPV16 infection in vivo.
10.1089/nat.2017.0687
Aptamer-based therapeutics: new approaches to combat human viral diseases.
Shum Ka-To,Zhou Jiehua,Rossi John J
Pharmaceuticals (Basel, Switzerland)
Viruses replicate inside the cells of an organism and continuously evolve to contend with an ever-changing environment. Many life-threatening diseases, such as AIDS, SARS, hepatitis and some cancers, are caused by viruses. Because viruses have small genome sizes and high mutability, there is currently a lack of and an urgent need for effective treatment for many viral pathogens. One approach that has recently received much attention is aptamer-based therapeutics. Aptamer technology has high target specificity and versatility, i.e., any viral proteins could potentially be targeted. Consequently, new aptamer-based therapeutics have the potential to lead a revolution in the development of anti-infective drugs. Additionally, aptamers can potentially bind any targets and any pathogen that is theoretically amenable to rapid targeting, making aptamers invaluable tools for treating a wide range of diseases. This review will provide a broad, comprehensive overview of viral therapies that use aptamers. The aptamer selection process will be described, followed by an explanation of the potential for treating virus infection by aptamers. Recent progress and prospective use of aptamers against a large variety of human viruses, such as HIV-1, HCV, HBV, SCoV, Rabies virus, HPV, HSV and influenza virus, with particular focus on clinical development of aptamers will also be described. Finally, we will discuss the challenges of advancing antiviral aptamer therapeutics and prospects for future success.
10.3390/ph6121507
A self-calibrating electrochemical aptasensing platform: Correcting external interference errors for the reliable and stable detection of avian influenza viruses.
Lee Inae,Kim Seong-Eun,Lee Jiho,Woo Deok Ha,Lee Seok,Pyo Heesoo,Song Chang-Seon,Lee Joonseok
Biosensors & bioelectronics
Conventional electrochemical biosensing systems rely on a single output signal, which limits their certain practical application, specifically from the viewpoint of external interference factors causing electrochemical signal errors. This study reports a self-calibrating dual-electrode based electrochemical aptasensor for the reliable and independent detection of avian influenza viruses (AIVs), which are the primary cause of highly contagious respiratory diseases, under external interference factors. Both electrodes were fabricated using tungsten rods surface-modified with a 3D nanostructured porous silica film (3DNRE). Subsequently, methylene blue (MB) was loaded as a redox-active material into the pores and capped with corresponding aptamer. One electrode was capped with an anti-AIV nucleoprotein (NP) aptamer (Apt-MB@3DNRE) allowing target-specific binding, resulting in changes in electrochemical signal upon diffusional release of the loaded redox molecules. The other electrode was capped with a control aptamer (Apt-MB@3DNRE), serving as a reference to correct false responses generated by nonspecific aptamer detachment and MB release under environmental changes in pH and ion strength and presence of nontarget molecules from cell lysis debris. In the dual-electrode platform, Apt-MB@3DNRE provides a corrected baseline for the fluctuating original output signals from Apt-MB@3DNRE. Consequently, this dual-electrode platform exhibits excellent output-signal stability (relative standard deviation, RSD: 5.86%) compared to a conventional single-electrode platform (RSD: 30.13%) at equivalent concentrations of AIV NP samples under different reaction buffer conditions. Moreover, no further purification and washing steps were required, indicating that the strategy may represent a universal and reliable platform for the electrochemical aptamer-based detection of various biomolecules.
10.1016/j.bios.2020.112010
Identification of aptamer-binding sites in hepatitis C virus envelope glycoprotein e2.
Chen Fan,Chen Si-Chong,Zhou Jing,Chen Zhi-De,Chen Fang
Iranian journal of medical sciences
Hepatitis C Virus (HCV) encodes two envelope glycoproteins, E1 and E2. Our previous work selected a specific aptamer ZE2, which could bind to E2 with high affinity, with a great potential for developing new molecular probes as an early diagnostic reagents or therapeutic drugs targeting HCV. In this study, the binding sites between E2 and aptamer ZE2 were further explored. E2 was truncated to 15 peptides (P1 to P15) and these peptides were used to detect the affinity with ZE2 by ELISA respectively. The peptide with high affinity was then further truncated, detected and compared with six kinds of HCV genotypes. The basic amino acid in 500 aa bound to ZE2 with high affinity, while acidic amino acid in 501 aa reduced the reaction between E2 and ZE2. The results showed the 500 aa and 501 aa of E2 were the key sites that bound to ZE2.
Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1.
Zhou Jiehua,Lazar Daniel,Li Haitang,Xia Xin,Satheesan Sangeetha,Charlins Paige,O'Mealy Denis,Akkina Ramesh,Saayman Sheena,Weinberg Marc S,Rossi John J,Morris Kevin V
Theranostics
Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates , HIV-1-infected humanized NOD/SCID/IL2 rγ mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1.
10.7150/thno.23085
Aptamer-based diagnostic and therapeutic approaches in animals: Current potential and challenges.
Devi Sapna,Sharma Neelesh,Ahmed Touqeer,Huma Zul I,Kour Savleen,Sahoo Bijayalaxmi,Singh Amit Kumar,Macesic Nino,Lee Sung Jin,Gupta Mukesh Kumar
Saudi journal of biological sciences
Fast and precise diagnosis of infectious and non-infectious animal diseases and their targeted treatments are of utmost importance for their clinical management. The existing biochemical, serological and molecular methods of disease diagnosis need improvement in their specificity, sensitivity and cost and, are generally not amenable for being used as points-of-care (POC) device. Further, with dramatic changes in environment and farm management practices, one should also arm ourselves and prepare for emerging and re-emerging animal diseases such as cancer, prion diseases, COVID-19, influenza etc. Aptamer - oligonucleotide or short peptides that can specifically bind to target molecules - have increasingly become popular in developing biosensors for sensitive detection of analytes, pathogens (bacteria, virus, fungus, prions), drug residues, toxins and, cancerous cells. They have also been proven successful in the cellular delivery of drugs and targeted therapy of infectious diseases and physiological disorders. However, the in vivo application of aptamer-mediated biosensing and therapy in animals has been limited. This paper reviews the existing reports on the application of aptamer-based biosensors and targeted therapy in animals. It also dissects the various modifications to aptamers that were found to be successful in application of the aptamers in diagnostics and therapeutics. Finally, it also highlights major challenges and future directions in the application of aptamers in the field of veterinary medicine.
10.1016/j.sjbs.2021.05.031
Improvement of the activity of the anti-HIV-1 integrase aptamer T30175 by introducing a modified thymidine into the loops.
Virgilio Antonella,Amato Teresa,Petraccone Luigi,Esposito Francesca,Grandi Nicole,Tramontano Enzo,Romero Raquel,Haider Shozeb,Gomez-Monterrey Isabel,Novellino Ettore,Mayol Luciano,Esposito Veronica,Galeone Aldo
Scientific reports
In this paper, we report our investigations on analogues of the anti-human immunodeficiency virus type 1 (HIV-1) integrase (IN) aptamer T30175 in which the individual thymidines forming the loops were replaced by 5-hydroxymethyl-2'-deoxyuridine residues (H). Circular dichroism, nuclear magnetic resonance and gel electrophoresis investigations clearly indicated that all the modified aptamers preserve the ability to form the original 5'-5' end-stacked head-to-head dimeric G-quadruplex structure, in which each G-quadruplex adopts a parallel arrangement and is characterized by three G-tetrads, three propeller loops and one bulge-loop. All the modified aptamers were tested in an IN inhibition LEDGF-independent assay. While the modified aptamers INTB-H13 and INTB-H17 showed IC values comparable with that of the parent aptamer (INTB-nat), analogues INTB-H2, INTB-H5 and, to a lesser extent, INTB-H9 showed a higher ability to inhibit the HIV IN than the unmodified aptamer. Molecular modelling studies evaluating the aptamer/HIV IN interaction highlighted the ability of the modified thymidines to establish several contacts with the target protein. All the data point to the importance of loops in the aptamer/target interaction and suggest that the site-specific replacement of loop residues with commercially available analogues can be considered a straightforward strategy to improve the biological activities of several G-quadruplex aptamers.
10.1038/s41598-018-25720-1
Aptamer Laden Liquid Crystals Biosensing Platform for the Detection of HIV-1 Glycoprotein-120.
Abbasi Amna Didar,Hussain Zakir,Yang Kun-Lin
Molecules (Basel, Switzerland)
We report a label-free and simple approach for the detection of glycoprotein-120 (gp-120) using an aptamer-based liquid crystals (LCs) biosensing platform. The LCs are supported on the surface of a modified glass slide with a suitable amount of B40t77 aptamer, allowing the LCs to be homeotropically aligned. A pronounced topological change was observed on the surface due to a specific interaction between B40t77 and gp-120, which led to the disruption of the homeotropic alignment of LCs. This results in a dark-to-bright transition observed under a polarized optical microscope. With the developed biosensing platform, it was possible to not only identify gp-120, but obtained results were analyzed quantitatively through image analysis. The detection limit of the proposed biosensing platform was investigated to be 0.2 µg/mL of gp-120. Regarding selectivity of the developed platform, no response could be detected when gp-120 was replaced by other proteins, such as bovine serum albumin (BSA), hepatitis A virus capsid protein 1 (Hep A VP1) and immunoglobulin G protein (IgG). Due to attributes such as label-free, high specificity and no need for instrumental read-out, the presented biosensing platform provides the potential to develop a working device for the quick detection of HIV-1 gp-120.
10.3390/molecules26102893
A DNA aptamer efficiently inhibits the infectivity of Bovine herpesvirus 1 by blocking viral entry.
Scientific reports
Bovine herpesvirus 1 (BoHV-1) is an important pathogen of domestic and wild cattle responsible for major economic losses in dairy and beef industries throughout the world. Inhibition of viral entry plays a crucial role in the control of BoHV-1 infection and aptamers have been reported to inhibit viral replication. In this study, nine DNA aptamers that target BoHV-1 were generated using systemic evolution of ligands by exponential enrichment. Of the nine candidates, aptamer IBRV-A4 exhibited the highest affinity and specificity for BoHV-1, which bound to BoHV-1 with a Kd value of 3.519 nM and demonstrated the greatest virus binding as shown by fluorescence imaging. The neutralizing ability of aptamer IBRV-A4 was determined using neutralization assays and real time PCR in BoHV-1 infected Madin-darby bovine kidney cells. Virus titration, immunofluorescence and confocal laser scanning microscopy showed virus replication significantly decreased when aptamer IBRV-A4 was added to BoHV-1 infected MDBK cells at 0 and 0.5 hours post-infection, whereas no change was seen when IBRV-A4 was added 2 hours post-infection. This concludes that aptamer IBRV-A4 efficiently inhibits viral entry of BoHV-1 in MDBK cells and is therefore a novel tool for diagnosis and treatment of BoHV-1 infection in cattle.
10.1038/s41598-017-10070-1
Detection of VR-2332 strain of porcine reproductive and respiratory syndrome virus type II using an aptamer-based sandwich-type assay.
Lee Su Jin,Kwon Young Seop,Lee Ji-eun,Choi Eun-Jin,Lee Chang-Hee,Song Jae-Young,Gu Man Bock
Analytical chemistry
Porcine reproductive and respiratory syndrome virus (PRRSV) causes porcine reproductive and respiratory syndrome disease (PRRS), a disease that has a significant and economic impact on the swine industry. In this study, single-stranded DNA (ssDNA) aptamers with high specificity and affinity against VR-2332 strain of PRRSV type II were successfully obtained. Of 19 candidates, the LB32 aptamer was found to be the most specific and sensitive to VR-2332 strain according to an aptamer-based surface plasmon resonance (SPR) analysis. The detection of VR-2332 of PRRSV type II was successfully accomplished using the enzyme-linked antibody-aptamer sandwich (ELAAS) method. The detection limit of ELAAS was 4.8 × 10(0) TCID(50)/mL that is comparable to some of the previous reports of the PCR-based detection but does not require any complicated equipment or extra costs. Moreover, this ELAAS-based PRRSV detection showed similar sensitivity for both the VR-2332 samples spiked in diluted swine serum and in buffer. Therefore, this VR-2332 strain-specific aptamer and its assay method with high specificity can be used as an alternative method for the fast and precise detection of PRRSV.
10.1021/ac3026866
Selection of DNA aptamers that bind to influenza A viruses with high affinity and broad subtype specificity.
Shiratori Ikuo,Akitomi Joe,Boltz David A,Horii Katsunori,Furuichi Makio,Waga Iwao
Biochemical and biophysical research communications
Many cases of influenza are reported worldwide every year. The influenza virus often acquires new antigenicity, which is known as antigenic shift; this results in the emergence of new virus strains, for which preexisting immunity is not found in the population resulting in influenza pandemics. In the event a new strain emerges, diagnostic tools must be developed rapidly to detect the novel influenza strain. The generation of high affinity antibodies is costly and takes time; therefore, an alternative detection system, aptamer detection, provides a viable alternative to antibodies as a diagnostic tool. In this study, we developed DNA aptamers that bind to HA1 proteins of multiple influenza A virus subtypes by the SELEX procedure. To evaluate the binding properties of these aptamers using colorimetric methods, we developed a novel aptamer-based sandwich detection method employing our newly identified aptamers. This novel sandwich enzyme-linked aptamer assay successfully detected the H5N1, H1N1, and H3N2 subtypes of influenza A virus with almost equal sensitivities. These findings suggest that our aptamers are attractive candidates for use as simple and sensitive diagnostic tools that need sandwich system for detecting the influenza A virus with broad subtype specificities.
10.1016/j.bbrc.2013.11.041
In Silico Selection of Gp120 ssDNA Aptamer to HIV-1.
SLAS discovery : advancing life sciences R & D
Nucleic acid aptamers that specifically bind to other molecules are mostly obtained through the systematic evolution of ligands by exponential enrichment (SELEX). Because SELEX is a time-consuming procedure, the in silico design of specific aptamers has recently become a progressive approach. HIV-1 surface glycoprotein gp120, which is involved in the early stages of HIV-1 infection, is an attractive target for RNA and DNA aptamer selection. In this study, four single-stranded DNA aptamers, referred to as HD2, HD3, HD4, and HD5, that had the ability of HIV-1 inhibition were designed in silico. In a proposed non-SELEX approach, some parts of the B40 aptamer sequence, which interacted with gp120, were isolated and considered as a separate aptamer sequence. Then, to obtain the best docking scores of the HDOCK server and Hex software, some modifications, insertions, and deletions were applied to each selected sequence. Finally, the cytotoxicity and HIV inhibition of the selected aptamers were evaluated experimentally. Results demonstrated that the selected aptamers could inhibit HIV-1 infection by up to 80%, without any cytotoxicity. Therefore, this new non-SELEX approach could be considered a simple, fast, and efficient method for aptamer selection.
10.1177/2472555220923331
Multifunctional electrochemical aptasensor for aptamer clones screening, virus quantitation in blood and viability assessment.
Labib Mahmoud,Zamay Anna S,Berezovski Maxim V
The Analyst
A novel attempt was made to develop a disposable multifunctional sensor for analysis of vaccinia virus (VACV), a promising oncolytic agent that can replicate in and kill tumor cells. Briefly, we developed aptamers specific to VACV that were negatively selected against human serum as well as human and mouse blood to be further utilized for viral analysis directly in serum and blood. In addition, the aptamers were negatively selected against heat-inactivated VACV to enable them to distinguish between viable and nonviable virus particles. The selected aptamers were integrated onto an electrochemical aptasensor to perform multiple functions, including quantification of VACV, viability assessment of the virus, and estimation of the binding affinity between the virus and the developed aptamers. The aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and a VACV-specific aptamer onto a gold nanoparticles modified screen-printed carbon electrode (GNPs-SPCE). Square wave voltammetry was employed to quantify VACV in serum and blood within the range of 150-900 PFU, with a detection limit of 60 PFU in 30 μL. According to the electrochemical affinity measurements, three virus specific aptamer clones, V-2, V-5, and V-9 exhibited the highest affinity to VACV. Furthermore, flow cytometry was employed to estimate the dissociation constants of the clones which were found to be 26.3, 40.9, and 24.7 nM, respectively. Finally, the developed aptasensor was able to distinguish between the intact virus and the heat-inactivated virus thanks to the tailored selectivity of the aptamers that was achieved via negative selection.
10.1039/c3an36771a
Fast and continuous microorganism detection using aptamer-conjugated fluorescent nanoparticles on an optofluidic platform.
Chung Jinyang,Kang Joon Sang,Jurng Jong Soo,Jung Jae Hee,Kim Byoung Chan
Biosensors & bioelectronics
Fast and accurate pathogen detection in aquatic environments is challenging in many biomedical studies and microbial diagnostic applications. In this study, we developed a real-time, continuous, and non-destructive single cell detection method using target specific aptamer-conjugated fluorescent nanoparticles (A-FNPs) and an optofluidic particle-sensor platform. A-FNPs selectively bound to the surfaces of target bacteria (Escherichia coli) and labeled them with high affinity and selectivity so that target bacteria can be countable particles in an optofluidic particle-sensor. A-FNP-labeled target bacterial complexes were detected by the optofluidic particle-sensing system, which provides rapid and continuous single-cell detection. A-FNPs selectively bound to E. coli with a dissociation constant of 0.83 nM, but did not bind Enterobacter aerogenes or Citrobacter freundii strains, which lacked affinity for the aptamer used. We demonstrated that our optofluidic device achieves a detection throughput of ~100 particles per second with high accuracy (~85%) in detecting single bacterial cells conjugated with A-FNPs. This approach can be immediately extended to the real-time, high-throughput detection of other microorganisms such as viruses that are selectively conjugated with A-FNPs. Collectively, these data suggest that optofluidic systems are widely applicable for the fast and continuous detection of microbial cells.
10.1016/j.bios.2014.08.039
Aptamer-facilitated Protection of Oncolytic Virus from Neutralizing Antibodies.
Molecular therapy. Nucleic acids
Oncolytic viruses promise to significantly improve current cancer treatments through their tumor-selective replication and multimodal attack against cancer cells. However, one of the biggest setbacks for oncolytic virus therapy is the intravenous delivery of the virus, as it can be cleared from the bloodstream by neutralizing antibodies before it reaches the tumor cells. We have selected DNA aptamers against an oncolytic virus, vesicular stomatitis virus, using a competitive binding approach, as well as against the antigen binding fragment (Fab) of antivesicular stomatitis virus polyclonal antibodies, in order to shield the virus from nAbs and enhance its in vivo survival. We used flow cytometry to identify these aptamers and evaluated their efficiency to shield vesicular stomatitis virus in a cell-based plaque forming assay. These oligonucleotides were then modified to obtain multivalent binders, which led to a decrease of viral aggregation, an increase in its infectivity and an increase in its stability in serum. The aptamers were also incubated in nondiluted serum, showing their effectiveness under conditions mimicking those in vivo. With this approach, we were able to increase viral infectivity by more than 70% in the presence of neutralizing antibodies. Thus, this method has the potential to enhance the delivery of vesicular stomatitis virus through the bloodstream without compromising the patient's immune system.
10.1038/mtna.2014.19
A double-imprinted diffraction-grating sensor based on a virus-responsive super-aptamer hydrogel derived from an impure extract.
Bai Wei,Spivak David A
Angewandte Chemie (International ed. in English)
The detection of viruses is of interest for a number of fields including biomedicine, environmental science, and biosecurity. Of particular interest are methods that do not require expensive equipment or trained personnel, especially if the results can be read by the naked eye. A new "double imprinting" method was developed whereby a virus-bioimprinted hydrogel is further micromolded into a diffraction grating sensor by using imprint-lithography techniques to give a "Molecularly Imprinted Polymer Gel Laser Diffraction Sensor" (MIP-GLaDiS). A simple laser transmission apparatus was used to measure diffraction, and the system can read by the naked eye to detect the Apple Stem Pitting Virus (ASPV) at concentrations as low as 10 ng mL(-1), thus setting the limit of detection of these hydrogels as low as other antigen-binding methods such as ELISA or fluorescence-tag systems.
10.1002/anie.201309462
Quantum dot-aptamer nanoprobes for recognizing and labeling influenza A virus particles.
Cui Zong-Qiang,Ren Qian,Wei Hong-Ping,Chen Ze,Deng Jiao-Yu,Zhang Zhi-Ping,Zhang Xian-En
Nanoscale
The fluorescence labeling of viruses is a useful technology for virus detection and imaging. By combining the excellent fluorescence properties of quantum dots (QDs) with the high affinity and specificity of aptamers, we constructed a QD-aptamer probe. The aptamer A22, against the hemagglutinin of influenza A virus, was linked to QDs, producing the QD-A22 probe. Fluorescence imaging and transmission electron microscopy showed that the QD-A22 probe could specifically recognize and label influenza A virus particles. This QD labeling technique provides a new strategy for labeling virus particles for virus detection and imaging.
10.1039/c1nr10218d
Application of Aptamer-Based Assays to the Diagnosis of Arboviruses Important for Public Health in Brazil.
International journal of molecular sciences
Arbovirus infections represent a global public health problem, and recent epidemics of yellow fever, dengue, and Zika have shown their critical importance in Brazil and worldwide. Whilst a major effort for vaccination programs has been in the spotlight, a number of aptamer approaches have been proposed in a complementary manner, offering the possibility of differential diagnosis between these arboviruses, which often present similar clinical symptoms, as well as the potential for a treatment option when no other alternative is available. In this review, we aim to provide a background on arbovirus, with a basic description of the main viral classes and the disease they cause, using the Brazilian context to build a comprehensive understanding of their role on a global scale. Subsequently, we offer an exhaustive revision of the diagnostic and therapeutic approaches offered by aptamers against arboviruses. We demonstrate how these promising reagents could help in the clinical diagnosis of this group of viruses, their use in a range of diagnostic formats, from biosensors to serological testing, and we give a short review on the potential approaches for novel aptamer-based antiviral treatment options against different arboviral diseases.
10.3390/ijms22010159
SARS-CoV-2 detection with aptamer-functionalized gold nanoparticles.
Talanta
A rapid detection test for SARS-CoV-2 is urgently required to monitor virus spread and containment. Here, we describe a test that uses nanoprobes, which are gold nanoparticles functionalized with an aptamer specific to the spike membrane protein of SARS-CoV-2. An enzyme-linked immunosorbent assay confirms aptamer binding with the spike protein on gold surfaces. Protein recognition occurs by adding a coagulant, where nanoprobes with no bound protein agglomerate while those with sufficient bound protein do not. Using plasmon absorbance spectra, the nanoprobes detect 16 nM and higher concentrations of spike protein in phosphate-buffered saline. The time-varying light absorbance is examined at 540 nm to determine the critical coagulant concentration required to agglomerates the nanoprobes, which depends on the protein concentration. This approach detects 3540 genome copies/μl of inactivated SARS-CoV-2.
10.1016/j.talanta.2021.122841
Aptamer BC 007 - Efficient binder of spreading-crucial SARS-CoV-2 proteins.
Weisshoff Hardy,Krylova Oxana,Nikolenko Heike,Düngen Hans-Dirk,Dallmann Andre,Becker Susanne,Göttel Peter,Müller Johannes,Haberland Annekathrin
Heliyon
Corona virus disease 2019 (COVID-19) is a respiratory disease caused by a new coronavirus (SARS-CoV-2) which causes significant morbidity and mortality. The emergence of this novel and highly pathogenic SARS-CoV-2 and its rapid international spread poses a serious global public health emergency. To date 32,174,627 cases, of which 962,613 (2.99%) have died, have been reported (https://www.who.int/westernpacific/health-topics/coronavirus, accessed 23 Sep 2020). The outbreak was declared a Public Health Emergency of International Concern on 30 January 2020. There are still not many SARS-CoV-2-specific and effective treatments or vaccines available. A second round of infection is obviously unavoidable. Aptamers had already been at the centre of interest in the fight against viruses before now. The selection and development of a new aptamer is, however, a time-consuming process. We therefore checked whether a clinically developed aptamer, BC 007, which is currently in phase 2 of clinical testing for a different indication, would also be able to efficiently bind DNA-susceptible peptide structures from SARS-CoV-2-spreading crucial proteins, such as the receptor binding domain (RBD) of the spike protein and the RNA dependent RNA polymerase of SARS-CoV-2 (re-purposing). Indeed, several such sequence-sections have been identified. In particular for two of these sequences, BC 007 showed specific binding in a therapy-relevant concentration range, as shown in Nuclear magnetic resonance (NMR)- and Circular dicroism (CD)-spectroscopy and isothermal titration calorimetry (ITC). The excellent clinical toxicity and tolerability profile of this substance opens up an opportunity for rapid clinical testing of its COVID-19 effectiveness.
10.1016/j.heliyon.2020.e05421
Selection and identification of an RNA aptamer that specifically binds the HIV-1 capsid lattice and inhibits viral replication.
Nucleic acids research
The HIV-1 capsid core participates in several replication processes. The mature capsid core is a lattice composed of capsid (CA) monomers thought to assemble first into CA dimers, then into ∼250 CA hexamers and 12 CA pentamers. CA assembly requires conformational flexibility of each unit, resulting in the presence of unique, solvent-accessible surfaces. Significant advances have improved our understanding of the roles of the capsid core in replication; however, the contributions of individual CA assembly forms remain unclear and there are limited tools available to evaluate these forms in vivo. Here, we have selected aptamers that bind CA lattice tubes. We describe aptamer CA15-2, which selectively binds CA lattice, but not CA monomer or CA hexamer, suggesting that it targets an interface present and accessible only on CA lattice. CA15-2 does not compete with PF74 for binding, indicating that it likely binds a non-overlapping site. Furthermore, CA15-2 inhibits HIV-1 replication when expressed in virus producer cells, but not target cells, suggesting that it binds a biologically-relevant site during virus production that is either not accessible during post-entry replication steps or is accessible but unaltered by aptamer binding. Importantly, CA15-2 represents the first aptamer that specifically recognizes the HIV-1 CA lattice.
10.1093/nar/gkab1293
Development, screening, and analysis of DNA aptamer libraries potentially useful for diagnosis and passive immunity of arboviruses.
Bruno John G,Carrillo Maria P,Richarte Alicia M,Phillips Taylor,Andrews Carrie,Lee John S
BMC research notes
BACKGROUND:Nucleic acid aptamers have long demonstrated the capacity to bind viral envelope proteins and to inhibit the progression of pathogenic virus infections. Here we report on initial efforts to develop and screen DNA aptamers against recombinant envelope proteins or synthetic peptides and whole inactivated viruses from several virulent arboviruses including Chikungunya, Crimean-Congo hemorrhagic fever (CCHF), dengue, tickborne encephalitis and West Nile viruses. We also analyzed sequence data and secondary structures for commonalities that might reveal consensus binding sites among the various aptamers. Some of the highest affinity and most specific aptamers in the down-selected libraries were demonstrated to have diagnostic utility in lateral flow chromatographic assays and in a fluorescent aptamer-magnetic bead sandwich assay. Some of the reported aptamers may also be able to bind viral envelope proteins in vivo and therefore may have antiviral potential in passive immunity or prophylactic applications. RESULTS:Several arbovirus DNA aptamer sequences emerged multiple times in the various down selected aptamer libraries thereby suggesting some consensus sequences for binding arbovirus envelope proteins. Screening of aptamers by enzyme-linked aptamer sorbent assay (ELASA) was useful for ranking relative aptamer affinities against their cognate viral targets. Additional study of the aptamer sequences and secondary structures of top-ranked anti-arboviral aptamers suggest potential virus binding motifs exist within some of the key aptamers and are highlighted in the supplemental figures for this article. One sequence segment (ACGGGTCCGGACA) emerged 60 times in the anti-CCHF aptamer library, but nowhere else in the anti-arbovirus library and only a few other times in a larger library of aptamers known to bind bacteria and rickettsia or other targets. Diagnostic utility of some of the aptamers for arbovirus detection in lateral flow chromatographic assays and a fluorescent sandwich assay on the surface of magnetic microbeads is also demonstrated. CONCLUSIONS:This article catalogues numerous DNA aptamer sequences which can bind various important pathogenic arboviruses and have, in some cases, already demonstrated diagnostic potential. These aptamer sequences are proprietary, patent-pending, and partially characterized. Therefore, they are offered to the scientific community for potential research use in diagnostic assays, biosensor applications or for possible passive immunity and prophylaxis against pathogenic viruses.
10.1186/1756-0500-5-633
A Universal DNA Aptamer that Recognizes Spike Proteins of Diverse SARS-CoV-2 Variants of Concern.
Chemistry (Weinheim an der Bergstrasse, Germany)
We report on a unique DNA aptamer, denoted MSA52, that displays universally high affinity for the spike proteins of wildtype SARS-CoV-2 as well as the Alpha, Beta, Gamma, Epsilon, Kappa, Delta and Omicron variants. Using an aptamer pool produced from round 13 of selection against the S1 domain of the wildtype spike protein, we carried out one-round SELEX experiments using five different trimeric spike proteins from variants, followed by high-throughput sequencing and sequence alignment analysis of aptamers that formed complexes with all proteins. A previously unidentified aptamer, MSA52, showed K values ranging from 2 to 10 nM for all variant spike proteins, and also bound similarly to variants not present in the reselection experiments. This aptamer also recognized pseudotyped lentiviruses (PL) expressing eight different spike proteins of SARS-CoV-2 with K values between 20 and 50 pM, and was integrated into a simple colorimetric assay for detection of multiple PL variants. This discovery provides evidence that aptamers can be generated with high affinity to multiple variants of a single protein, including emerging variants, making it well-suited for molecular recognition of rapidly evolving targets such as those found in SARS-CoV-2.
10.1002/chem.202200078
Monitoring Intact Viruses Using Aptamers.
Kumar Penmetcha K R
Biosensors
Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review.
10.3390/bios6030040
Aptamer-based Emerging Tools for Viral Biomarker Detection: A Focus on SARS-CoV-2.
Current medicinal chemistry
Viral infections can cause fatal illnesses to humans as well as animals. Early detection of viruses is therefore crucial to provide effective treatment to patients. Recently, the Covid-19 pandemic has undoubtedly given an alarming call to develop rapid and sensitive detection platforms. The viral diagnostic tools need to be fast, affordable, and easy to operate with high sensitivity and specificity equivalent or superior to the currently used diagnostic methods. The present detection methods include direct detection of viral antigens or measuring the response of antibodies to viral infections. However, the sensitivity and quantification of the virus are still a significant challenge. Detection tools employing synthetic binding molecules like aptamers may provide several advantages over the conventional methods that use antibodies in the assay format. Aptamers are highly stable and tailorable molecules and are therefore ideal for detection and chemical sensing applications. This review article discusses various advances made in aptamer-based viral detection platforms, including electrochemical, optical, and colorimetric methods to detect viruses, specifically SARS-Cov-2. Considering the several advantages, aptamers could be game-changing in designing high-throughput biosensors for viruses and other biomedical applications in the future.
10.2174/1568009622666220214101059
Cell-type-specific aptamer and aptamer-small interfering RNA conjugates for targeted human immunodeficiency virus type 1 therapy.
Zhou Jiehua,Rossi John
Journal of investigative medicine : the official publication of the American Federation for Clinical Research
Human immunodeficiency virus (HIV) is a virus that causes acquired immunodeficiency syndrome, a chronic and incurable disease of the human immune system. As the standard of care for the patients with HIV-1, current highly active antiretroviral treatment has been therapeutically effective in most patients; however, it is not curative, and highly active antiretroviral treatment is intolerable because of severe adverse effects. Therefore, nucleic acid-based therapeutics, such as antisense oligonucleotide, ribozyme, messenger RNA, RNA interference (RNAi)-based therapeutics, aptamer, and so on, have been actively developed as alternative or adjuvant agents for those chemical antiviral drugs to surmount those drawbacks. The combinatorial use of various antiviral nucleic acids could be more efficacious in blocking viral replication and preventing the emergence of resistant variants. In this regard, RNAi can function as a gene-specific therapeutic option for controlling HIV-1 replication. Another type of therapeutic nucleic acid--aptamers--shows promise as a new and potent class of anti-HIV agent and can additionally function as a cell-type-specific delivery vehicle for targeted RNAi. The combined use of small interfering RNA (siRNAs) and aptamers could effectively block viral replication and prevent the emergence of resistant variants. The present review offers a brief overview of the use of cell-type-specific aptamer and aptamer-siRNA conjugates' development in our group for the treatment of HIV-1. Their potentials for targeted delivering RNAi therapeutics (eg, siRNA) and suppressing HIV-1 replication in vitro and in humanized animal model will be highlighted here.
10.1097/JIM.0000000000000103
A SARS-CoV-2 Spike Binding DNA Aptamer that Inhibits Pseudovirus Infection by an RBD-Independent Mechanism*.
Angewandte Chemie (International ed. in English)
The receptor binding domain (RBD) of the spike glycoprotein of the coronavirus SARS-CoV-2 (CoV2-S) binds to the human angiotensin-converting enzyme 2 (ACE2) representing the initial contact point for leveraging the infection cascade. We used an automated selection process and identified an aptamer that specifically interacts with CoV2-S. The aptamer does not bind to the RBD of CoV2-S and does not block the interaction of CoV2-S with ACE2. Nevertheless, infection studies revealed potent and specific inhibition of pseudoviral infection by the aptamer. The present study opens up new vistas in developing SARS-CoV2 infection inhibitors, independent of blocking the ACE2 interaction of the virus, and harnesses aptamers as potential drug candidates and tools to disentangle hitherto inaccessible infection modalities, which is of particular interest in light of the increasing number of escape mutants that are currently being reported.
10.1002/anie.202100316
Aptamer-based biosensors for the rapid visual detection of flu viruses.
Le T T,Adamiak B,Benton D J,Johnson C J,Sharma S,Fenton R,McCauley J W,Iqbal M,Cass A E G
Chemical communications (Cambridge, England)
RNA aptamers showing affinity and specificity for different strains of human influenza virus were assembled onto gold nanoparticles that subsequently formed a gold nanoshell (AuNS) around the viral envelope. These shells could be visualised by transmission electron microscopy (TEM). Changes in size and structure of the AuNS coated virus can be used to detect the viruses. We show that sedimentation with a low cost centrifuge and visual determination can detect 3 × 10(8) viral particles.
10.1039/c4cc07888h
Direct detection of human adenovirus or SARS-CoV-2 with ability to inform infectivity using DNA aptamer-nanopore sensors.
Peinetti Ana S,Lake Ryan J,Cong Wen,Cooper Laura,Wu Yuting,Ma Yuan,Pawel Gregory T,Toimil-Molares María Eugenia,Trautmann Christina,Rong Lijun,Mariñas Benito,Azzaroni Omar,Lu Yi
Science advances
Viral infections are a major global health issue, but no current method allows rapid, direct, and ultrasensitive quantification of intact viruses with the ability to inform infectivity, causing misdiagnoses and spread of the viruses. Here, we report a method for direct detection and differentiation of infectious from noninfectious human adenovirus and SARS-CoV-2, as well as from other virus types, without any sample pretreatment. DNA aptamers are selected from a DNA library to bind intact infectious, but not noninfectious, virus and then incorporated into a solid-state nanopore, which allows strong confinement of the virus to enhance sensitivity down to 1 pfu/ml for human adenovirus and 1 × 10 copies/ml for SARS-CoV-2. Applications of the aptamer-nanopore sensors in different types of water samples, saliva, and serum are demonstrated for both enveloped and nonenveloped viruses, making the sensor generally applicable for detecting these and other emerging viruses of environmental and public health concern.
10.1126/sciadv.abh2848
Targeted in vitro photodynamic therapy via aptamer-labeled, porphyrin-loaded virus capsids.
Cohen Brian A,Bergkvist Magnus
Journal of photochemistry and photobiology. B, Biology
Virus capsids have emerged as multifunctional platform systems for development of bio-derived nanomaterials. In this work we investigate the use of aptamer decorated MS2 bacteriophage capsids, loaded with photosensitizer for targeted photodynamic therapy in vitro. MS2 capsids were loaded with approximately 250 cationic porphyrins through a novel assembly packaging mechanism, followed by exterior decoration of the capsid with a cancer-targeting nucleic acid aptamer via chemical conjugation. The ability of these aptamer-virus-porphyrin constructs to specifically target and eradicate MCF-7 human breast cancer cells upon photoactivation was assessed. Photoinduced cytotoxicity was evaluated via live/dead staining and a metabolic activity assay with MCF-10A cells as a control. Results show that MCF-7 cells incubated with targeted, porphyrin-loaded virus capsids exhibited cell death whereas the MCF-10A cells did not. Furthermore, MCF-7 cells incubated with porphyrin-loaded viruses decorated with a non-targeting aptamer exhibited no observable phototoxicity. Combined, the results presented in this work demonstrate our unique virus-based loading strategy offers a viable approach for efficient targeted delivery of photoactive compounds for site-specific photodynamic cancer therapy using bio-derived nanomaterials.
10.1016/j.jphotobiol.2013.02.013
Aptamer-based biochips for label-free detection of plant virus coat proteins by SPR imaging.
Lautner Gergely,Balogh Zsófia,Bardóczy Viola,Mészáros Tamás,Gyurcsányi Róbert E
The Analyst
Specific detection of virus strains by affinity-based bioassays is often limited by the availability of ligands able to differentiate among close homologues of virus coat proteins. As viruses are prone to mutation, the ligand generation should, in addition, be fast enough to allow rapid identification of new varieties. These two criteria are difficult to be fulfilled by antibodies; however, they open up opportunities for aptamer-based detection. Here we report on the feasibility of selectively detecting the apple stem pitting virus (ASPV) coat proteins (PSA-H, MT32) using original DNA aptamers. Surface plasmon resonance (SPR) imaging was used together with aptamer-modified sensor chips to optimize the aptamer immobilization for highest sensitivity and to characterize the aptamer-virus coat protein binding. Different parameters affecting this binding, such as the aptamer flanking, surface coverage, and type of spacer molecules, were identified and their influence was determined. A direct label-free method is proposed for assessing the ASPV based on the detection of the respective virus coat proteins in plant extracts.
10.1039/b922829b
Construction of DNA-NanoLuc luciferase conjugates for DNA aptamer-based sandwich assay using Rep protein.
Mie Masayasu,Niimi Takahiro,Mashimo Yasumasa,Kobatake Eiry
Biotechnology letters
OBJECTIVE:We developed a DNA-NanoLuc luciferase (NnaoLuc) conjugates for DNA aptamer-based sandwich assay using the catalytic domain of the replication initiator protein derived from porcine circovirus type 2 (pRep). RESULTS:For construction of DNA aptamer and NanoLuc conjugate using the catalytic domain of Rep from PCV2. pRep fused to NanoLuc was genetically constructed and expressed in E. coli. After purification, the activities of fused pRep and NanoLuc were evaluated, and DNA-NanoLuc conjugates were constructed via the fused pRep. Finally, constructed DNA-NanoLuc conjugates were applied for use in a DNA aptamer-based sandwich assay. Here, pRep was used not only for conjugation of the NanoLuc to the detection aptamer, but also for immobilization of the capture aptamer on the plate surface. CONCLUSION:We have demonstrated that DNA-NanoLuc conjugates via the catalytic domain of PCV2 Rep could be applied for DNA aptamer-based sandwich assay system.
10.1007/s10529-018-02641-7
Methods and Applications of In Silico Aptamer Design and Modeling.
International journal of molecular sciences
Aptamers are nucleic acid analogues of antibodies with high affinity to different targets, such as cells, viruses, proteins, inorganic materials, and coenzymes. Empirical approaches allow the design of in vitro aptamers that bind particularly to a target molecule with high affinity and selectivity. Theoretical methods allow significant expansion of the possibilities of aptamer design. In this study, we review theoretical and joint theoretical-experimental studies dedicated to aptamer design and modeling. We consider aptamers with different targets, such as proteins, antibiotics, organophosphates, nucleobases, amino acids, and drugs. During nucleic acid modeling and in silico design, a full set of in silico methods can be applied, such as docking, molecular dynamics (MD), and statistical analysis. The typical modeling workflow starts with structure prediction. Then, docking of target and aptamer is performed. Next, MD simulations are performed, which allows for an evaluation of the stability of aptamer/ligand complexes and determination of the binding energies with higher accuracy. Then, aptamer/ligand interactions are analyzed, and mutations of studied aptamers made. Subsequently, the whole procedure of molecular modeling can be reiterated. Thus, the interactions between aptamers and their ligands are complex and difficult to understand using only experimental approaches. Docking and MD are irreplaceable when aptamers are studied in silico.
10.3390/ijms21228420
Binding interface and impact on protease cleavage for an RNA aptamer to HIV-1 reverse transcriptase.
Nguyen Phuong D M,Zheng Jie,Gremminger Thomas J,Qiu Liming,Zhang Dong,Tuske Steve,Lange Margaret J,Griffin Patrick R,Arnold Eddy,Chen Shi-Jie,Zou Xiaoqin,Heng Xiao,Burke Donald H
Nucleic acids research
RNA aptamers that bind HIV-1 reverse transcriptase (RT) inhibit RT in enzymatic and viral replication assays. Some aptamers inhibit RT from only a few viral clades, while others show broad-spectrum inhibition. Biophysical determinants of recognition specificity are poorly understood. We investigated the interface between HIV-1 RT and a broad-spectrum UCAA-family aptamer. SAR and hydroxyl radical probing identified aptamer structural elements critical for inhibition and established the role of signature UCAA bulge motif in RT-aptamer interaction. HDX footprinting on RT ± aptamer shows strong contacts with both subunits, especially near the C-terminus of p51. Alanine scanning revealed decreased inhibition by the aptamer for mutants P420A, L422A and K424A. 2D proton nuclear magnetic resonance and SAXS data provided constraints on the solution structure of the aptamer and enable computational modeling of the docked complex with RT. Surprisingly, the aptamer enhanced proteolytic cleavage of precursor p66/p66 by HIV-1 protease, suggesting that it stabilizes the productive conformation to allow maturation. These results illuminate features at the RT-aptamer interface that govern recognition specificity by a broad-spectrum antiviral aptamer, and they open new possibilities for accelerating RT maturation and interfering with viral replication.
10.1093/nar/gkz1224
Development of a biosensor from aptamers for detection of the porcine reproductive and respiratory syndrome virus.
Kuitio Chakpetch,Rasri Natchaya,Kiriwan Duangnapa,Unajak Sasimanas,Choowongkomon Kiattawee
Journal of veterinary science
BACKGROUND:Recently, the pork industry of Thailand faced an epidemic of highly virulent strains of porcine reproductive and respiratory syndrome virus (PRRSV), which spread throughout Southeast Asia, including the Lao People's Democratic Republic and Cambodia. Hence, the rapid and on-site screening of infected pigs on a farm is essential. OBJECTIVES:To develop the new aptamer as a biosensor for detection PRRSV which are rapid and on-site screening of infected pig. METHODS:New aptamers against PRSSV were identified using the combined techniques of capillary electrophoresis, colorimetric assay by gold nanoparticles, and quartz crystal microbalance (QCM). RESULTS:Thirty-six candidate aptamers of the PRRSV were identified from the systematic evolution of ligands by exponential enrichment (SELEX) by capillary electrophoresis. Only 8 out of 36 aptamers could bind to the PRSSV, as shown in a colorimetric assay. Of the 8 aptamers tested, only the 1F aptamer could bind specifically to the PRSSV when presented with the classical swine fever virus and a pseudo rabies virus. The QCM was used to confirm the specificity and sensitivity of the 1F aptamer with a detection limit of 1.87 × 10 particles. CONCLUSIONS:SELEX screening of the aptamer equipped with capillary electrophoresis potentially revealed promising candidates for detecting the PRRSV. The 1F aptamer exhibited the highest specificity and selectivity against the PRRSV. These findings suggest that 1F is a promising aptamer for further developing a novel PRRSV rapid detection kit.
10.4142/jvs.2020.21.e79
Aptamer-facilitated cryoprotection of viruses.
Ghobadloo Shahrokh M,Gargaun Ana,Casselman Rebecca,Muharemagic Darija,Berezovski Maxim V
ACS medicinal chemistry letters
Global vaccination and gene therapy programs have an urgent demand for stabilization of viral vectors at low temperature. We used a quadramer, a bridge-connected DNA tetra-aptamer to antivesicular stomatitis virus (VSV), as a viral cryoprotectant. Results showed that the tetravalent antivirus DNA aptamers protect viral activity during multiple freeze-thaw cycles, shield from neutralizing antibodies, and decrease aggregation of viral particles.
10.1021/ml500322h
DNA aptamer against EV-A71 VP1 protein: selection and application.
Zou Xinran,Wu Jing,Gu Jiaqi,Shen Li,Mao Lingxiang
Virology journal
BACKGROUND:Enterovirus 71 (EV-A71) is a highly infectious pathogen associated with hand, foot and mouth disease, herpangina, and various neurological complications, so it is important for the early detection and treatment of EV-A71. An aptamer is a nucleotide sequence that screened in vitro by the technology named systematic evolution of ligands by exponential enrichment technology (SELEX). Similar to antibodies, aptamers can bind to the targets with high specificity and affinity. Besides, emerging aptamers have many advantages comparing with antibodies, such as ease of synthesis and modification, having a wide variety of target materials, low manufacturing cost and easy flexibility in amending. Therefore, aptamers are promising in virus detection and anti-virus therapy. METHODS:Aptamers were selected by SELEX. Specificity, affinity and second structure were used to characterize the selected aptamers. Chemiluminescence was adopted to build an aptamer-based detection method for EV-A71. Cytopathogenic effects trial, the level of intracellular EV-A71 RNA and protein expression were used to evaluate the antiviral effect of the selected aptamers. RESULTS:Three DNA aptamers with high specificity and affinity for EV-A71structual protein VP1 were screened out. A rapid chemiluminutesescence aptamer biosensor for EV-A71 detection was designed out. The selected aptamers could inhibit the RNA replication and protein expression of EV-A71 in RD cells and ameliorate the cytopathogenic effects. CONCLUSIONS:The aptamers against EV-A71 have the potentiality to be applied as attractive candidates used for EV-A71 detection and treatment in the future.
10.1186/s12985-021-01631-y
Electrochemical sensing of aptamer-facilitated virus immunoshielding.
Labib Mahmoud,Zamay Anna S,Muharemagic Darija,Chechik Alexey,Bell John C,Berezovski Maxim V
Analytical chemistry
Oncolytic viruses (OVs) are promising therapeutics that selectively replicate in and kill tumor cells. However, repetitive administration of OVs provokes the generation of neutralizing antibodies (nAbs) that can diminish their anticancer effects. In this work, we selected DNA aptamers against an oncolytic virus, vesicular stomatitis virus (VSV), to protect it from nAbs. A label-free electrochemical aptasensor was used to evaluate the degree of protection (DoP). The aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and a VSV-specific aptamer. Electrochemical impedance spectroscopy was employed to quantitate VSV in the range of 800-2200 PFU and a detection limit of 600 PFU. The aptasensor was also utilized for evaluating binding affinities between VSV and aptamer pools/clones. An electrochemical displacement assay was performed in the presence of nAbs and DoP values were calculated for several VSV-aptamer pools/clones. A parallel flow cytometric analysis confirmed the electrochemical results. Finally, four VSV-specific aptamer clones, ZMYK-20, ZMYK-22, ZMYK-23, and ZMYK-28, showed the highest protective properties with dissociation constants of 17, 8, 20, and 13 nM, respectively. Another four sequences, ZMYK-1, -21, -25, and -29, exhibited high affinities to VSV without protecting it from nAbs and can be further utilized in sandwich assays. Thus, ZMYK-22, -23, and -28 have the potential to allow efficient delivery of VSV through the bloodstream without compromising the patient's immune system.
10.1021/ac202978r
Screening and application of a broad-spectrum aptamer for acyclic guanosine analogues.
Ren Le,Qi Shuo,Khan Imran Mahmood,Wu Shijia,Duan Nuo,Wang Zhouping
Analytical and bioanalytical chemistry
Acyclic guanosine analogues, a class of widely used antiviral drugs, can cause chronic toxicity and virus resistance. Therefore, it is essential to establish rapid and accurate methods to detect acyclic guanosine analogues. In this study, five acyclic guanosine analogues (acyclovir, famciclovir, ganciclovir, penciclovir, and valaciclovir) were used as positive targets to obtain broad-spectrum aptamers through Capture-SELEX technology. Real-time quantitative PCR (Q-PCR) was used to monitor the aptamer SELEX process. After the sixteen rounds of selection against mixed targets, sequences were obtained by high-throughput sequencing (HTS). Furthermore, a broad-spectrum aptamer, named CIV6, was found as the higher performance aptamer that was suitable for five acyclic guanosine analogues by graphene oxide (GO) polarization and fluorescence assay. Finally, the aptamer CIV6 was used to construct GO fluorescence assay to detect five acyclic guanosine analogues. The limits of detection (LOD) of acyclovir, famciclovir, ganciclovir, penciclovir, and valaciclovir were 0.48 ng·mL, 0.53 ng·mL, 0.50 ng·mL, 0.56 ng·mL, and 0.38 ng·mL, respectively.
10.1007/s00216-021-03446-w
Inhibition of hepatitis C virus infection by DNA aptamer against envelope protein.
Yang Darong,Meng Xianghe,Yu Qinqin,Xu Li,Long Ying,Liu Bin,Fang Xiaohong,Zhu Haizhen
Antimicrobial agents and chemotherapy
Hepatitis C virus (HCV) envelope protein (E1E2) is essential for virus binding to host cells. Aptamers have been demonstrated to have strong promising applications in drug development. In the current study, a cDNA fragment encoding the entire E1E2 gene of HCV was cloned. E1E2 protein was expressed and purified. Aptamers for E1E2 were selected by the method of selective evolution of ligands by exponential enrichment (SELEX), and the antiviral actions of the aptamers were examined. The mechanism of their antiviral activity was investigated. The data show that selected aptamers for E1E2 specifically recognize the recombinant E1E2 protein and E1E2 protein from HCV-infected cells. CD81 protein blocks the binding of aptamer E1E2-6 to E1E2 protein. Aptamers against E1E2 inhibit HCV infection in an infectious cell culture system although they have no effect on HCV replication in a replicon cell line. Beta interferon (IFN-β) and IFN-stimulated genes (ISGs) are not induced in virus-infected hepatocytes with aptamer treatment, suggesting that E1E2-specific aptamers do not induce innate immunity. E2 protein is essential for the inhibition of HCV infection by aptamer E1E2-6, and the aptamer binding sites are located in E2. Q412R within E1E2 is the major resistance substitution identified. The data indicate that an aptamer against E1E2 exerts its antiviral effects through inhibition of virus binding to host cells. Aptamers against E1E2 can be used with envelope protein to understand the mechanisms of HCV entry and fusion. The aptamers may hold promise for development as therapeutic drugs for hepatitis C patients.
10.1128/AAC.00897-13
Inhibition of hepatitis C virus infection by NS5A-specific aptamer.
Yu Xiaoyan,Gao Yimin,Xue Binbin,Wang Xiaohong,Yang Darong,Qin Yuwen,Yu Rong,Liu Nianli,Xu Li,Fang Xiaohong,Zhu Haizhen
Antiviral research
To increase efficacy of hepatitis C treatment, future regiments will incorporate multiple direct-acting antiviral drugs. HCV NS5A protein was expressed and purified. Aptamers against NS5A were screened and obtained by the selective evolution of ligands by exponential enrichment approach and the antiviral actions of the aptamers were tested. The mechanisms through which the aptamers exert their antiviral activity were explored. The aptamers NS5A-4 and NS5A-5 inhibit HCV RNA replication and infectious virus production without causing cytotoxicity in human hepatocytes. The aptamers do not affect hepatitis B virus replication in HepG2.2.15 cells. Interferon beta (IFN-β) and interferon-stimulated genes (ISGs) are not induced by the aptamers in HCV-infected hepatocytes. Further study shows that domain I and domain III of NS5A protein are involved in the suppression of HCV RNA replication and infectious virus production by NS5A-4. Y2105H within NS5A is the major resistance mutation identified. NS5A aptamer disrupts the interaction of NS5A with core protein. The data suggest that the aptamers against NS5A protein may exert antiviral effects through inhibiting viral RNA replication, preventing the interaction of NS5A with core protein. Aptamers for NS5A may be used to understand the mechanisms of virus replication and assembly and served as potential therapeutic agents for hepatitis C.
10.1016/j.antiviral.2014.03.020
Aptamer-based electrochemical biosensor for rapid detection of SARS-CoV-2: Nanoscale electrode-aptamer-SARS-CoV-2 imaging by photo-induced force microscopy.
Biosensors & bioelectronics
Rapid, mass diagnosis of the coronavirus disease 2019 (COVID-19) is critical to stop the ongoing infection spread. The two standard screening methods to confirm the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are polymerase chain reaction (PCR), through the RNA of the virus, and serology by detecting antibodies produced as a response to the viral infection. However, given the detection complexity, cost and relatively long analysis times of these techniques, novel technologies are urgently needed. Here, we report an aptamer-based biosensor developed on a screen-printed carbon electrode platform for rapid, sensitive, and user-friendly detection of SARS-CoV-2. The aptasensor relies on an aptamer targeting the receptor-binding domain (RBD) in the spike protein (S-protein) of the SARS-CoV-2. The aptamer immobilization on gold nanoparticles, and the presence of S-protein in the aptamer-target complex, investigated for the first time by photo-induced force microscopy mapping between 770 and 1910 cm of the electromagnetic spectrum, revealed abundant S-protein homogeneously distributed on the sensing probe. The detection of SARS-CoV-2 S-protein was achieved by electrochemical impedance spectroscopy after 40 min incubation with several analyte concentrations, yielding a limit of detection of 1.30 pM (66 pg/mL). Moreover, the aptasensor was successfully applied for the detection of a SARS-CoV-2 pseudovirus, thus suggesting it is a promising tool for the diagnosis of COVID-19.
10.1016/j.bios.2021.113595
Detection of Hepatitis C Virus Core Protein in Serum Using Aptamer-Functionalized AFM Chips.
Micromachines
In the present study, we demonstrate atomic force microscopy (AFM)-based detection of hepatitis C virus (HCV) particles in serum samples using a chip with aptamer-functionalized surface (apta-based AFM chip). The target particles, containing core antigen of HCV (HCVcoreAg protein), were biospecifically captured onto the chip surface from 1 mL of test solution containing 10 µL of serum collected from a hepatitis C patient. The registration of aptamer/antigen complexes on the chip surface was performed by AFM. The aptamers used in the present study were initially developed for therapeutic purposes; herein, these aptamers have been successfully utilized as probe molecules for HCVcoreAg detection in the presence of a complex protein matrix (human serum). The results obtained herein can be used for the development of detection systems that employ affine enrichment for protein detection.
10.3390/mi10020129
Selection of an antiviral RNA aptamer against hemagglutinin of the subtype H5 avian influenza virus.
Park Sun Young,Kim Seho,Yoon Hana,Kim Kyung-Bo,Kalme Sheetal S,Oh Sangtaek,Song Chang Seon,Kim Dong-Eun
Nucleic acid therapeutics
Avian influenza is an acute viral respiratory disease caused by RNA viruses of the family Orthomyxoviridae. The influenza A virus subtype H5 can cause severe illness and results in almost 100% mortality rate among livestock. Hemagglutinin (HA) present in the virus envelope plays an essential role in the initiation of viral infection. In this study, we investigated the efficacy of using HA as a target for antiviral therapy through nucleic acid aptamers. After purification of the receptor binding domain (HA1) of HA protein, activity of recombinant HA1 was confirmed by using hemagglutination assay. We selected RNA aptamer candidates after 15 rounds of iterative Systematic Evolution of Ligands by EXponential enrichment (SELEX) targeting the biologically active HA protein. The selected RNA aptamer HAS15-5, which specifically binds to HA1, exhibited significant antiviral efficacy according to the results of a hemagglutination inhibition assay using egg allantoic fluids harboring the virus. Thus, the RNA aptamer HAS15-5, which acts by blocking and inhibiting the receptor-binding domain of viral HA, can be developed as a novel antiviral agent against type H5 avian influenza virus.
10.1089/nat.2011.0321
Structure and Sequence Determinants Governing the Interactions of RNAs with Influenza A Virus Non-Structural Protein NS1.
Viruses
The non-structural protein NS1 of influenza A viruses is an RNA-binding protein of which its activities in the infected cell contribute to the success of the viral cycle, notably through interferon antagonism. We have previously shown that NS1 strongly binds RNA aptamers harbouring virus-specific sequence motifs (Marc et al., Nucleic Acids Res. 41, 434-449). Here, we started out investigating the putative role of one particular virus-specific motif through the phenotypic characterization of mutant viruses that were genetically engineered from the parental strain WSN. Unexpectedly, our data did not evidence biological importance of the putative binding of NS1 to this specific motif (UGAUUGAAG) in the 3'-untranslated region of its own mRNA. Next, we sought to identify specificity determinants in the NS1-RNA interaction through interaction assays in vitro with several RNA ligands and through solving by X-ray diffraction the 3D structure of several complexes associating NS1's RBD with RNAs of various affinities. Our data show that the RBD binds the GUAAC motif within double-stranded RNA helices with an apparent specificity that may rely on the sequence-encoded ability of the RNA to bend its axis. On the other hand, we showed that the RBD binds to the virus-specific AGCAAAAG motif when it is exposed in the apical loop of a high-affinity RNA aptamer, probably through a distinct mode of interaction that still requires structural characterization. Our data are consistent with more than one mode of interaction of NS1's RBD with RNAs, recognizing both structure and sequence determinants.
10.3390/v12090947
Specific determination of HBV using a viral aptamer molecular imprinting polymer sensor based on ratiometric metal organic framework.
Wang Lingyun,Yang Junyu,Tang Li,Luo Lianghui,Chen Chunyan,Gong Hang,Cai Changqun
Mikrochimica acta
An approach is reported based on the combination of aptamer and metal organic frameworks (MOF) to prepare a molecularly imprinted sensor that recognizes viruses with high specificity and sensitivity. Using MIL-101-NH as a polymer carrier, viral aptamers were introduced into the carrier surface through an amide reaction to specifically identify the target, and surface imprinting is carried out through tetraethyl silicate (TEOS) self-polymerization. The MIL-101-NH is also used as the reference fluorescence signal (λex/λem = 290/460 nm) and rhodamine B as the change signal (λex/λem = 550/570 nm). The ratiometric fluorescence detection and dual recognition strategy not only reduce environmental interference but also greatly improve the sensor's anti-interference ability, the obtained imprinting factor was 5.72, and the detection limit as low as 1.8 pmol L. Therefore, the molecular imprinting sensor designed realizes the specific and highly sensitive identification of viruses, which provides theoretical support for the application of molecular imprinting technology in clinical diagnosis of viruses. Graphical abstract Aptamer-molecular imprinting polymer based on metal-organic framework ratiometric fluorescent detect virus.
10.1007/s00604-021-04858-2
Detection of an IL-6 Biomarker Using a GFET Platform Developed with a Facile Organic Solvent-Free Aptamer Immobilization Approach.
Sensors (Basel, Switzerland)
Aptamer-immobilized graphene field-effect transistors (GFETs) have become a well-known detection platform in the field of biosensing with various biomarkers such as proteins, bacteria, virus, as well as chemicals. A conventional aptamer immobilization technique on graphene involves a two-step crosslinking process. In the first step, a pyrene derivative is anchored onto the surface of graphene and, in the second step, an amine-terminated aptamer is crosslinked to the pyrene backbone with EDC/NHS (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride/N-hydroxysuccinimide) chemistry. However, this process often requires the use of organic solvents such as dimethyl formamide (DMF) or dimethyl sulfoxide (DMSO) which are typically polar aprotic solvents and hence dissolves both polar and nonpolar compounds. The use of such solvents can be especially problematic in the fabrication of lab-on-a-chip or point-of-care diagnostic platforms as they can attack vulnerable materials such as polymers, passivation layers and microfluidic tubing leading to device damage and fluid leakage. To remedy such challenges, in this work, we demonstrate the use of pyrene-tagged DNA aptamers (PTDA) for performing a one-step aptamer immobilization technique to implement a GFET-based biosensor for the detection of Interleukin-6 (IL-6) protein biomarker. In this approach, the aptamer terminal is pre-tagged with a pyrene group which becomes soluble in aqueous solution. This obviates the need for using organic solvents, thereby enhancing the device integrity. In addition, an external electric field is applied during the functionalization step to increase the efficiency of aptamer immobilization and hence improved coverage and density. The results from this work could potentially open up new avenues for the use of GFET-based BioMEMS platforms by broadening the choice of materials used for device fabrication and integration.
10.3390/s21041335
Selection of an aptamer against Muscovy duck parvovirus for highly sensitive rapid visual detection by label-free aptasensor.
Lu Taofeng,Ma Qin,Yan Wenzhuo,Wang Yuanzhi,Zhang Yuanyuan,Zhao Lili,Chen Hongyan
Talanta
Muscovy duck parvovirus (MDPV) causes high mortality and morbidity in ducks. This study investigated a novel aptamer-based, label-free aptasensor detection of MDPV. In this study, we developed an ssDNA aptamer using the filtration partition and lambda exonuclease method with an affinity-based monitor and counter-screening process. After 15 rounds of SELEX (systematic evolution of ligands by exponential enrichment), the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity (K = 467nM) was successfully screened, and the aptamer was also found to be good specific to MDPV. The selected Apt-10 aptamer can be used to distinguish MDPV and goose parvovirus (GPV). Three-dimensional structural analysis of the Apt-10 aptamer indicated that it folded into a compact stem-loop motif, which was related to its high affinity. Finally, a label-free detection method based on unmodified gold nanoparticles and Apt-10 aptamer was developed for MDPV determination. The concentration of Apt-10 aptamer at 5μM was optimal for MDPV determination in the label-free aptasensor. Excellent linearity was acquired and the lowest detection limit was 1.5 or 3 EID (50% egg infection dose) of MDPV, respectively, depending upon spectrophotometry or the naked eye were used. These results show the potential of the aptamer for the rapid detection of MDPV and antiviral research.
10.1016/j.talanta.2017.08.037
Probing and characterizing the high specific sequences of ssDNA aptamer against SGIV-infected cells.
Li Pengfei,Yu Qing,Zhou Lingli,Dong Dexin,Wei Shina,Ya Hanzheng,Chen Bo,Qin Qiwei
Virus research
As the major viral pathogen of grouper aquaculture, Singapore grouper iridovirus (SGIV) has caused great economic losses in China and Southeast Asia. In the previous study, we have generated highly specific ssDNA aptamers against SGIV-infected grouper spleen cells (GS) by Systematic Evolution of Ligands by Exponential Enrichment technology (SELEX), in which Q2 had the highest binding affinity of 16.43 nM. In this study, we would try to identify the specific sequences in the aptamer Q2 that exhibited the high binding affinity to SGIV-infected cells by truncating the original Q2 into some different specific segments. We first evaluated the specificity and binding affinity of these truncated aptamers to SGIV-infected cells by flow cytometry, fluorescent imaging of cells and aptamer-based enzyme-linked apta-sorbent assay (ELASA). We then performed cytotoxicity analysis, assessment of the inhibitory effects upon SGIV infection and the celluar internalization kinetics of each truncated aptamer. Compared to the initial Q2, one of the truncated aptamer Q2-C5 showed a 3-fold increase in the binding affinity for SGIV-infected cells, and held more effective inhibitory effects, higher internalization kinetics and stability. Hence, the aptamer's truncated methods could be applied in the research of identifying aptamer's key sequences. The shorter, structure optimizing aptamer showed more excellent performance over the originally selected aptamer, which could potentially be applied in developing commercial detection probes for the early and rapid diagnosis of SGIV infection, and highly specific therapeutic drugs against SGIV infection.
10.1016/j.virusres.2018.01.006
An optimized aptamer-binding viral tegument protein VP8 inhibits the production of Bovine Herpesvirus-1 through blocking nucleocytoplasmic shuttling.
Xu Jian,Cai Yunhong,Jiang Bo,Li Xiaoyang,Jin Huan,Liu Wenxiao,Kong Zimeng,Hong Jiabing,Sealy Joshua E,Iqbal Munir,Li Yongqing
International journal of biological macromolecules
Bovine herpesvirus 1 (BoHV-1) is a major pathogen of infectious bovine rhinotracheitis in bovine. Previously, we generated the aptamer IBRV A4 using systemic evolution of ligands by exponential enrichment. This aptamer inhibited infectivity of BoHV-1 by blocking viral particle absorption onto cell membranes. In this study, we found that the major tegument protein VP8 of BoHV-1 was involved in inhibition of infectious virus production by IBRV A4. We improved the affinity of IBRV A4 for VP8 by optimizing aptamer's structure and repeat conformation. An optimized aptamer, IBRV A4.7, was constructed with quadruple binding sites and a new stem-loop structure, which had a stronger binding affinity for VP8 or BoHV-1 than raw aptamer IBRV A4. IBRV A4.7 bound to VP8 with a dissociation constant (Kd) value of 0.2054 ± 0.03948 nM and bound to BoHV-1 with a Kd value of 0.3637 ± 0.05452 nM. Crucially, IBRV A4.7 had improved antiviral activity compared to IBRV A4, with a half-maximal inhibitory concentration of 1.16 ± 0.042 μM. Our results also revealed IBRV A4.7 inhibited BoHV-1 production in MDBK cells through blocking nucleocytoplasmic shuttling of viral VP8 in BoHV-1-infected MDBK cells. In conclusion, the aptamer IBRV A4.7 may have potency in preventing outbreaks in herds due to reactivation of latency.
10.1016/j.ijbiomac.2019.08.165
An Aptamer against the Matrix Binding Domain on the Hepatitis B Virus Capsid Impairs Virion Formation.
Orabi Ahmed,Bieringer Maria,Geerlof Arie,Bruss Volker
Journal of virology
UNLABELLED:The hepatitis B virus (HBV) particle is an icosahedral nucleocapsid surrounded by a lipid envelope containing viral surface proteins. A small domain (matrix domain [MD]) in the large surface protein L and a narrow region (matrix binding domain [MBD]) including isoleucine 126 on the capsid surface have been mapped, in which point mutations such as core I126A specifically blocked nucleocapsid envelopment. It is possible that the two domains interact with each other during virion morphogenesis. By the systematic evolution of ligands by exponential enrichment (SELEX) method, we evolved DNA aptamers from an oligonucleotide library binding to purified recombinant capsids but not binding to the corresponding I126A mutant capsids. Aptamers bound to capsids were separated from unbound molecules by filtration. After 13 rounds of selections and amplifications, 16 different aptamers were found among 73 clones. The four most frequent aptamers represented more than 50% of the clones. The main aptamer, AO-01 (13 clones, 18%), showed the lowest dissociation constant (Kd) of 180 ± 82 nM for capsid binding among the four molecules. Its Kd for I126A capsids was 1,306 ± 503 nM. Cotransfection of Huh7 cells with AO-01 and an HBV genomic construct resulted in 47% inhibition of virion production at 3 days posttransfection, but there was no inhibition by cotransfection of an aptamer with a random sequence. The half-life of AO-01 in cells was 2 h, which might explain the incomplete inhibition. The results support the importance of the MBD for nucleocapsid envelopment. Inhibiting the MD-MBD interaction with a low-molecular-weight substance might represent a new approach for an antiviral therapy. IMPORTANCE:Approximately 240 million people are persistently infected with HBV. To date, antiviral therapies depend on a single target, the viral reverse transcriptase. Future additional targets could be viral protein-protein interactions. We selected a 55-base-long single-stranded DNA molecule (aptamer) which binds with relatively high affinity to a region on the HBV capsid interacting with viral envelope proteins during budding. This aptamer inhibits virion formation in cell culture. The results substantiate the current model for HBV morphogenesis and show that the capsid envelope interaction is a potential antiviral target.
10.1128/JVI.00466-15
A DNA Aptamer Against Influenza A Virus: An Effective Inhibitor to the Hemagglutinin-Glycan Interactions.
Li Wenkai,Feng Xinru,Yan Xing,Liu Keyi,Deng Le
Nucleic acid therapeutics
Most therapeutical nucleic acid aptamers tend to inhibit protein-protein interactions and thereby function as antagonists. Attachment of the influenza virus surface glycoprotein hemagglutinin (HA) to sialic acid-containing host cell receptors (glycan) facilitates the initial stage of viral infection. Inhibition of the attachment may result in an antiviral effect on the proliferation of the influenza virus. To develop therapeutically interesting agents, we selected two single-stranded DNA (ssDNA) aptamers specific to the HA protein of H1N1 influenza virus (A/Puerto Rico/8/1934) through a procedure of systematic evolution of ligands by exponential enrichment. As it showed a higher binding affinity for HA protein (Kd = 78 ± 1 nM), aptamer 1 was tested for its ability to interfere with HA-glycan interactions using chicken red blood cell hemagglutination and microneutralization assays, which demonstrated that it significantly suppressed the viral infection in host cells. These results indicate that the isolated ssDNA aptamer may be developed as an antiviral agent against influenza through appropriate therapeutic formulation.
10.1089/nat.2015.0564
Aptamer-based viability impedimetric sensor for viruses.
Labib Mahmoud,Zamay Anna S,Muharemagic Darija,Chechik Alexey V,Bell John C,Berezovski Maxim V
Analytical chemistry
The development of aptamer-based viability impedimetric sensor for viruses (AptaVISens-V) is presented. Highly specific DNA aptamers to intact vaccinia virus were selected using cell-SELEX technique and integrated into impedimetric sensors via self-assembly onto a gold microelectrode. Remarkably, this aptasensor is highly selective and can successfully detect viable vaccinia virus particles (down to 60 virions in a microliter) and distinguish them from nonviable viruses in a label-free electrochemical assay format. It also opens a new venue for the development of a variety of viability sensors for detection of many microorganisms and spores.
10.1021/ac203412m
Aptamer Sandwich Lateral Flow Assay (AptaFlow) for Antibody-Free SARS-CoV-2 Detection.
Analytical chemistry
The COVID-19 pandemic is among the greatest health and socioeconomic crises in recent history. Although COVID-19 vaccines are being distributed, there remains a need for rapid testing to limit viral spread from infected individuals. We previously identified the SARS-CoV-2 spike protein N-terminal domain (NTD) binding DNA aptamer 1 (SNAP1) for detection of SARS-CoV-2 virus by aptamer-antibody sandwich enzyme-linked immunoassay (ELISA) and lateral flow assay (LFA). In this work, we identify a new aptamer that also binds at the NTD, named SARS-CoV-2 spike protein NTD-binding DNA aptamer 4 (SNAP4). SNAP4 binds with high affinity (<30 nM) for the SARS-CoV-2 spike protein, a 2-fold improvement over SNAP1. Furthermore, we utilized both SNAP1 and SNAP4 in an aptamer sandwich LFA (AptaFlow), which detected SARS-CoV-2 UV-inactivated virus at concentrations as low as 10 copies/mL. AptaFlow costs <$1 per test to produce, provides results in <1 h, and detects SARS-CoV-2 at concentrations that indicate higher viral loads and a high probability of contagious transmission. AptaFlow is a potential approach for a low-cost, convenient antigen test to aid the control of the COVID-19 pandemic.
10.1021/acs.analchem.2c00554
Graphene oxide and Lambda exonuclease assisted screening of L-carnitine aptamers and the site-directed mutagenesis design of C-rich structure aptamer.
Xing Ligang,Zhao Yanmei,Gong Mingzhu,Liu Xia,Zhang Yuhui,Li Dan,He Zefeng,Yan Ping,Yang Jidong
Biochemical and biophysical research communications
In this study, Graphene Oxide (GO) was used to screen the binding with the aptamers of L-carnitine chiral enantiomers. The ssDNA library was prepared by the method of Lambda exonuclease. In addition, a simple casing device was designed to improve the purification and recovery efficiency of the small ssDNA fragments in the process of screening. Finally, more than 160,000 aptamer sequences were obtained by high-throughput sequencing. We determined the strongest affinity aptamer sequence, CA04, by the Resonance Rayleigh scattering (RRS) technology. We also analyzed the key binding sites (in the 16th position case) of the truncated aptamer sequence CAD10. Interestingly, we found that aptamer CA10 and CA06 were both C-rich bases through sequence alignment and analysis, and the aptamer CA10 was confirmed that the CA10 and CA06 were formed under acidic conditions (pH 4.5) by CD spectrum and ESI-MS analysis. The interaction between gold nanoparticles (AuNPs) and functionalized aptamer CA10 was analyzed. We used Site-directed mutagenesis design and QGRS Mapper to optimize aptamer CA10, where an optimal aptamer CA10-03 were obtained after affinity analysis. It is also proved to be an effective method to obtain stronger affinity aptamer. Meanwhile, Native-PAGE and UV spectrum analysis were performed on the mutation sequences, and the interaction with ThT was analyzed. Finally, it is hoped that my study can provide help for later identification and detection of L-carnitine.
10.1016/j.bbrc.2021.01.044
Amperometric bioaffinity sensing platform for avian influenza virus proteins with aptamer modified gold nanoparticles on carbon chips.
Diba Farhana Sharmin,Kim Suhee,Lee Hye Jin
Biosensors & bioelectronics
A sandwich assay platform involving a surface formed aptamer-protein-antibody complex was developed to obtain the highly selective and sensitive amperometric detection of H5N1 viral proteins using a gold nanoparticle (NP) modified electrode. This is the first aptamer-antibody pairing reported for the selective detection of H5N1. Nanoparticle deposited screen-printed carbon electrodes were first functionalized by the covalent immobilization of a DNA aptamer specific to H5N1 followed by the adsorption of H5N1 protein. Alkaline phosphatase (ALP) conjugated monoclonal antibody was then adsorbed to form a surface bound Au NPs-aptamer/H5N1/antiH5N1-ALP sandwich complex which was further reacted with the enzyme substrate, 4-amino phenyl phosphate (APP). The current associated with the electrocatalytic reaction of the surface bound ALP with APP increased as the H5N1 concentration increased. A lowest detectable concentration of 100 fM was obtained with a linear dynamic range of 100 fM to 10 pM using differential pulse voltammetry. As an example, the biosensor was applied to the detection of H5N1 protein in diluted human serum samples spiked with different concentrations of the viral protein target.
10.1016/j.bios.2015.05.020
A high-affinity aptamer with base-appended base-modified DNA bound to isolated authentic SARS-CoV-2 strains wild-type and B.1.617.2 (delta variant).
Biochemical and biophysical research communications
Simple, highly sensitive detection technologies for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are crucial for the effective implementation of public health policies. We used the systematic evolution of ligands by exponential enrichment with a modified DNA library, including a base-appended base (uracil with a guanine base at its fifth position), to create an aptamer with a high affinity for the receptor-binding domain (RBD) of the SARS-CoV-2 spike glycoprotein. The aptamer had a dissociation constant of 1.2 and < 1 nM for the RBD and spike trimer, respectively. Furthermore, enzyme-linked aptamer assays confirmed that the aptamer binds to isolated authentic SARS-CoV-2 wild-type and B.1.617.2 (delta variant). The binding signal was larger that of commercially available anti-SARS-CoV-2 RBD antibody. Thus, this aptamer as a sensing element will enable the highly sensitive detection of SARS-CoV-2.
10.1016/j.bbrc.2022.04.071
Selection of an aptamer against rabies virus: a new class of molecules with antiviral activity.
Liang Hong-Ru,Hu Gui-Qiu,Xue Xiang-Hong,Li Lu,Zheng Xue-Xing,Gao Yu-Wei,Yang Song-Tao,Xia Xian-Zhu
Virus research
Rabies is a fatal central nervous system (CNS) disease caused by the neurotropic rabies virus (RABV). The therapeutic management of RABV infections is still problematic, and novel antiviral strategies are urgently required. We established the RVG-BHK-21 cell line, which expresses RABV glycoprotein on the cell surface, to select aptamers. Through 28 iterative rounds of selection, single-stranded DNA (ssDNA) aptamers were generated by exponential enrichment (SELEX). A virus titer assay and a real-time quantitative reverse transcription PCR (qRT-PCR) assay revealed that four aptamers could inhibit the replication of RABV in cultured baby hamster kidney (BHK)-21 cells. However, the aptamers did not inhibit the replication of other virus, e.g., canine distemper virus (CDV) and canine parvovirus (CPV). In addition, the GE54 aptamer was found to effectively protect mice against lethal RABV challenge. After inoculation with aptamers for 24h or 48h, followed by inoculation with CVS-11, approximately 25-33% of the mice survived. In summary, we selected aptamers that could significantly protect from a lethal dose of RABV in vitro and in vivo.
10.1016/j.virusres.2014.01.021
A novel G-quadruplex aptamer-based spike trimeric antigen test for the detection of SARS-CoV-2.
Molecular therapy. Nucleic acids
The recent SARS-CoV-2 outbreak has been declared a global health emergency. It will take years to vaccinate the whole population to protect them from this deadly virus, hence the management of SARS-CoV-2 largely depends on the widespread availability of an accurate diagnostic test. Toward addressing the unmet need of a reliable diagnostic test in the current work by utilizing the power of Systematic Evolution of Ligands by EXponential enrichment, a 44-mer G-quadruplex-forming DNA aptamer against spike trimer antigen of SARS-CoV-2 was identified. The lead aptamer candidate (S14) was characterized thoroughly for its binding, selectivity, affinity, structure, and batch-to-batch variability by utilizing various biochemical, biophysical, and techniques. S14 has demonstrated a low nanomolar K, confirming its tight binding to a spike antigen of SARS-CoV-2. S14 can detect as low as 2 nM of antigen. The clinical evaluation of S14 aptamer on nasopharyngeal swab specimens (n = 232) has displayed a highly discriminatory response between SARS-CoV-2 infected individuals from the non-infected one with a sensitivity and specificity of ∼91% and 98%, respectively. Importantly, S14 aptamer-based test has evinced a comparable performance with that of RT-PCR-based assay. Altogether, this study established the utility of aptamer technology for the detection of SARS-CoV-2.
10.1016/j.omtn.2021.06.014
Structural and Functional Aspects of G-Quadruplex Aptamers Which Bind a Broad Range of Influenza A Viruses.
Novoseltseva Anastasia A,Ivanov Nikita M,Novikov Roman A,Tkachev Yaroslav V,Bunin Dmitry A,Gambaryan Alexandra S,Tashlitsky Vadim N,Arutyunyan Alexander M,Kopylov Alexey M,Zavyalova Elena G
Biomolecules
An aptamer is a synthetic oligonucleotide with a unique spatial structure that provides specific binding to a target. To date, several aptamers to hemagglutinin of the influenza A virus have been described, which vary in affinity and strain specificity. Among them, the DNA aptamer RHA0385 is able to recognize influenza hemagglutinins with highly variable sequences. In this paper, the structure of RHA0385 was studied by circular dichroism spectroscopy, nuclear magnetic resonance, and size-exclusion chromatography, demonstrating the formation of a parallel G-quadruplex structure. Three derivatives of RHA0385 were designed in order to determine the contribution of the major loop to affinity. Shortening of the major loop from seven to three nucleotides led to stabilization of the scaffold. The affinities of the derivatives were studied by surface plasmon resonance and an enzyme-linked aptamer assay on recombinant hemagglutinins and viral particles, respectively. The alterations in the loop affected the binding to influenza hemagglutinin, but did not abolish it. Contrary to aptamer RHA0385, two of the designed aptamers were shown to be conformationally homogeneous, retaining high affinities and broad binding abilities for both recombinant hemagglutinins and whole influenza A viruses.
10.3390/biom10010119
High-performance interactive analysis of split aptamer and HIV-1 Tat on multiwall carbon nanotube-modified field-effect transistor.
Fatin M F,Rahim Ruslinda A,Gopinath Subash C B,Arshad M K Md
International journal of biological macromolecules
Interaction between split RNA aptamer and the clinically important target, HIV-1 Tat was investigated on a biosensing surface transduced by functionally choreographed multiwall carbon nanotubes (MWCNTs). Acid oxidation was performed to functionalize MWCNTs with carboxyl functional groups. X-ray photoelectron spectroscopy analysis had profound ~2.91% increment in overall oxygen group and ~1% increment was noticed with a specific carboxyl content owing to CO and OCO bonding. The interaction between split RNA aptamer and HIV-1 Tat protein was quantified by electrical measurements with the current signal (I) over a gate voltage (V). Initially, 34.4 mV gate voltage shift was observed by the immobilization of aptamer on MWCNT. With aptamer and HIV-1 Tat interaction, the current flow was decreased with the concomitant gate voltage shift of 23.5 mV. The attainment of sensitivity with split aptamer and HIV-1 Tat interaction on the fabricated device was 600 pM. To ensure the genuine interaction of aptamer with HIV-1 Tat, other HIV-1 proteins, Nef and p24 were interacted with aptamer and they displayed the negligible interferences with gate voltage shift of 3.5 mV and 5.7 mV, which shows 4 and 2.5 folds lesser than HIV-1 Tat interaction, respectively.
10.1016/j.ijbiomac.2018.12.066
Inhibition of hepatitis C virus infection by DNA aptamer against NS2 protein.
Gao Yimin,Yu Xiaoyan,Xue Binbin,Zhou Fei,Wang Xiaohong,Yang Darong,Liu Nianli,Xu Li,Fang Xiaohong,Zhu Haizhen
PloS one
NS2 protein is essential for hepatitis C virus (HCV) replication. NS2 protein was expressed and purified. Aptamers against NS2 protein were raised and antiviral effects of the aptamers were examined. The molecular mechanism through which the aptamers exert their anti-HCV activity was investigated. The data showed that aptamer NS2-3 inhibited HCV RNA replication in replicon cell line and infectious HCV cell culture system. NS2-3 and another aptamer NS2-2 were demonstrated to inhibit infectious virus production without cytotoxicity in vitro. They did not affect hepatitis B virus replication. Interferon beta (IFN-β) and interferon-stimulated genes (ISGs) were not induced by the aptamers in HCV-infected hepatocytes. Furthermore, our study showed that N-terminal region of NS2 protein is involved in the inhibition of HCV infection by NS2-2. I861T within NS2 is the major resistance mutation identified. Aptamer NS2-2 disrupts the interaction of NS2 with NS5A protein. The data suggest that NS2-2 aptamer against NS2 protein exerts its antiviral effects through binding to the N-terminal of NS2 and disrupting the interaction of NS2 with NS5A protein. NS2-specific aptamer is the first NS2 inhibitor and can be used to understand the mechanisms of virus replication and assembly. It may be served as attractive candidates for inclusion in the future HCV direct-acting antiviral combination therapies.
10.1371/journal.pone.0090333
Structure of an RNA Aptamer that Can Inhibit HIV-1 by Blocking Rev-Cognate RNA (RRE) Binding and Rev-Rev Association.
Dearborn Altaira D,Eren Elif,Watts Norman R,Palmer Ira W,Kaufman Joshua D,Steven Alasdair C,Wingfield Paul T
Structure (London, England : 1993)
HIV-1 Rev protein mediates nuclear export of unspliced and partially spliced viral RNAs for production of viral genomes and structural proteins. Rev assembles on a 351-nt Rev response element (RRE) within viral transcripts and recruits host export machinery. Small (<40-nt) RNA aptamers that compete with the RRE for Rev binding inhibit HIV-1 viral replication. We determined the X-ray crystal structure of a potential anti-HIV-1 aptamer that binds Rev with high affinity (K = 5.9 nM). The aptamer is structurally similar to the RRE high-affinity site but forms additional contacts with Rev unique to its sequence. Exposed bases of the aptamer interleave with the guanidinium groups of two arginines of Rev, forming stacking interactions and hydrogen bonds. The aptamer also obstructs an oligomerization interface of Rev, blocking Rev self-assembly. We propose that this aptamer can inhibit HIV-1 replication by interfering with Rev-RRE, Rev-Rev, and possibly Rev-host protein interactions.
10.1016/j.str.2018.06.001
Aptamer BC 007's Affinity to Specific and Less-Specific Anti-SARS-CoV-2 Neutralizing Antibodies.
Haberland Annekathrin,Krylova Oxana,Nikolenko Heike,Göttel Peter,Dallmann Andre,Müller Johannes,Weisshoff Hardy
Viruses
COVID-19 is a pandemic respiratory disease that is caused by the highly infectious severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Anti-SARS-CoV-2 antibodies are essential weapons that a patient with COVID-19 has to combat the disease. When now repurposing a drug, namely an aptamer that interacts with SARS-CoV-2 proteins for COVID-19 treatment (BC 007), which is, however, a neutralizer of pathogenic autoantibodies in its original indication, the possibility of also binding and neutralizing anti-SARS-CoV-2 antibodies must be considered. Here, the highly specific virus-neutralizing antibodies have to be distinguished from the ones that also show cross-reactivity to tissues. The last-mentioned could be the origin of the widely reported SARS-CoV-2-induced autoimmunity, which should also become a target of therapy. We, therefore, used enzyme-linked immunosorbent assay (ELISA) technology to assess the binding of well-characterized publicly accessible anti-SARS-CoV-2 antibodies (CV07-209 and CV07-270) with BC 007. Nuclear magnetic resonance spectroscopy, isothermal calorimetric titration, and circular dichroism spectroscopy were additionally used to test the binding of BC 007 to DNA-binding sequence segments of these antibodies. BC 007 did not bind to the highly specific neutralizing anti-SARS-CoV-2 antibody but did bind to the less specific one. This, however, was a lot less compared to an autoantibody of its original indication (14.2%, range 11.0-21.5%). It was also interesting to see that the less-specific anti-SARS-CoV-2 antibody also showed a high background signal in the ELISA (binding on NeutrAvidin-coated or activated but noncoated plastic plate). These initial experiments suggest that the risk of binding and neutralizing highly specific anti-SARS CoV-2 antibodies by BC 007 should be low.
10.3390/v13050932
Pharmacokinetics of a Cholesterol-conjugated Aptamer Against the Hepatitis C Virus (HCV) NS5B Protein.
Molecular therapy. Nucleic acids
Hepatitis C virus (HCV) is the major cause of progressive liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Previously, we reported that a 29 nucleotide-long 2'-F pyrimidine modified RNA aptamer against the HCV nonstructural protein 5B efficiently inhibited HCV replication and suppressed HCV infectious virus particle formation in a cell culture system. In this study, we modified this aptamer through conjugation of cholesterol for in vivo availability. This cholesterol-conjugated aptamer (chol-aptamer) efficiently entered the cell and inhibited HCV RNA replication, without any alteration in gene expression profiling including innate immune response-related genes. Moreover, systemic administration of the chol-aptamer was well tolerated without any abnormalities in mice. To evaluate the pharmacokinetics of the chol-aptamer in vivo, dose proportionality, bioavailability, and pharmacokinetic parameters were evaluated by noncompartmental analyses in normal BALB/c mice. Population analysis was performed using nonlinear mixed effects modeling. Moreover, the pharmacokinetics of two different routes (intravenous, IV, versus intraperitoneal, IP) were compared. Cholesterol conjugation showed dose proportionality, extended the time that the aptamer was in the plasma, and enhanced aptamer exposure to the body. Noticeably, the IV route was more suitable than the IP route due to the chol-aptamer remaining in the plasma for a longer period of time.
10.1038/mtna.2015.30
Targeting Herpes Simplex Virus-1 gD by a DNA Aptamer Can Be an Effective New Strategy to Curb Viral Infection.
Yadavalli Tejabhiram,Agelidis Alex,Jaishankar Dinesh,Mangano Kyle,Thakkar Neel,Penmetcha Kumar,Shukla Deepak
Molecular therapy. Nucleic acids
Herpes simplex virus type 1 (HSV-1) is an important factor for vision loss in developed countries. A challenging aspect of the ocular infection by HSV-1 is that common treatments, such as acyclovir, fail to provide effective topical remedies. Furthermore, it is not very clear whether the viral glycoproteins, required for HSV-1 entry into the host, can be targeted for an effective therapy against ocular herpes in vivo. Here, we demonstrate that HSV-1 envelope glycoprotein gD, which is essential for viral entry and spread, can be specifically targeted by topical applications of a small DNA aptamer to effectively control ocular infection by the virus. Our 45-nt-long DNA aptamer showed high affinity for HSV-1 gD (binding affinity constant [K] = 50 nM), which is strong enough to disrupt the binding of gD to its cognate host receptors. Our studies showed significant restriction of viral entry and replication in both in vitro and ex vivo studies. In vivo experiments in mice also resulted in loss of ocular infection under prophylactic treatment and statistically significant lower infection under therapeutic modality compared to random DNA controls. Thus, our studies validate the possibility that targeting HSV-1 entry glycoproteins, such as gD, can locally reduce the spread of infection and define a novel DNA aptamer-based approach to control HSV-1 infection of the eye.
10.1016/j.omtn.2017.10.009
Aptamer that binds to the gD protein of herpes simplex virus 1 and efficiently inhibits viral entry.
Gopinath Subash C B,Hayashi Kyoko,Kumar Penmetcha K R
Journal of virology
The ectodomain of the gD protein of herpes simplex viruses (HSVs) plays an important role in viral entry by binding to specific cellular coreceptors and mediating viral entry to the host cells. In the present study, we isolated RNA aptamers (aptamer-1 and aptamer-5) that specifically bind to the gD protein of HSV-1 with high affinity and are able to discriminate the gD protein of a different virus, HSV-2. Aptamer-1 efficiently interfered with the interaction between the gD protein and the HSV-1 target cell receptor (HVEM) in a dose-dependent manner. The 50% effective concentration (EC(50)) of aptamer-1 was estimated to be in the nanomolar range (60 nM). Furthermore, aptamer-1 was analyzed for anti-HSV-1 activity by using plaque assays, and it efficiently inhibited viral entry with an estimated K(i) of 0.8 μM. To expand the future applications of aptamer-1, a shorter variant was designed by using both mapping and boundary analyses, resulting in the mini-1 aptamer (44-mer). Compared to the full-length aptamer, mini-1 had at least as high an affinity, specificity, and ability to interfere with gD-HVEM interactions. These studies suggest that the mini-1 aptamer could be explored further as an anti-HSV-1 topical therapy designed to prevent the risk of acquiring HSV-1 infection through physical contact.
10.1128/JVI.00377-12
Molecular imprinted polymer combined with aptamer (MIP-aptamer) as a hybrid dual recognition element for bio(chemical) sensing applications. Review.
Ali Gona K,Omer Khalid M
Talanta
The development of diagnostic devices based on memetic molecular recognitions are becoming highly promising due to high specificity, sensitivity, stability, and low-cost comparing to natural molecular recognition. During the last decade, molecular imprinted polymers (MIPs) and aptamer have shown dramatic enhancement in the molecular recognition characteristics for bio(chemical) sensing applications. Recently, MIP-aptamer, as an emerging hybrid recognition element, merged the advantages of the both recognition components. This dual recognition-based sensor has shown improved properties and desirable features, such as high sensitivity, low limit of detection, high stability under harsh environmental conditions, high binding affinity, and superior selectivity. Hybrid MIP-aptamer as dual recognition element, was used in the real sample analysis, such as detection of proteins, neurotransmitters, environmental pollutants, biogenic compounds, small ions, explosives, virus detections and pharmaceuticals. This review focuses on a comprehensive overview of the preparation strategies of various MIP-aptamer recognition elements, mechanism of formation of MIP-aptamer, and detection of various target molecules in different matrices.
10.1016/j.talanta.2021.122878
Designing anti-influenza aptamers: novel quantitative structure activity relationship approach gives insights into aptamer-virus interaction.
Musafia Boaz,Oren-Banaroya Rony,Noiman Silvia
PloS one
This study describes the development of aptamers as a therapy against influenza virus infection. Aptamers are oligonucleotides (like ssDNA or RNA) that are capable of binding to a variety of molecular targets with high affinity and specificity. We have studied the ssDNA aptamer BV02, which was designed to inhibit influenza infection by targeting the hemagglutinin viral protein, a protein that facilitates the first stage of the virus' infection. While testing other aptamers and during lead optimization, we realized that the dominant characteristics that determine the aptamer's binding to the influenza virus may not necessarily be sequence-specific, as with other known aptamers, but rather depend on general 2D structural motifs. We adopted QSAR (quantitative structure activity relationship) tool and developed computational algorithm that correlate six calculated structural and physicochemical properties to the aptamers' binding affinity to the virus. The QSAR study provided us with a predictive tool of the binding potential of an aptamer to the influenza virus. The correlation between the calculated and actual binding was R2 = 0.702 for the training set, and R2 = 0.66 for the independent test set. Moreover, in the test set the model's sensitivity was 89%, and the specificity was 87%, in selecting aptamers with enhanced viral binding. The most important properties that positively correlated with the aptamer's binding were the aptamer length, 2D-loops and repeating sequences of C nucleotides. Based on the structure-activity study, we have managed to produce aptamers having viral affinity that was more than 20 times higher than that of the original BV02 aptamer. Further testing of influenza infection in cell culture and animal models yielded aptamers with 10 to 15 times greater anti-viral activity than the BV02 aptamer. Our insights concerning the mechanism of action and the structural and physicochemical properties that govern the interaction with the influenza virus are discussed.
10.1371/journal.pone.0097696
Cross-protection of influenza A virus infection by a DNA aptamer targeting the PA endonuclease domain.
Yuan Shuofeng,Zhang Naru,Singh Kailash,Shuai Huiping,Chu Hin,Zhou Jie,Chow Billy K C,Zheng Bo-Jian
Antimicrobial agents and chemotherapy
Amino acid residues in the N-terminal of the PA subunit (PAN) of the influenza A virus polymerase play critical roles in endonuclease activity, protein stability, and viral RNA (vRNA) promoter binding. In addition, PAN is highly conserved among different subtypes of influenza virus, which suggests PAN to be a desired target in the development of anti-influenza agents. We selected DNA aptamers targeting the intact PA protein or the PAN domain of an H5N1 virus strain using systematic evolution of ligands by exponential enrichment (SELEX). The binding affinities of selected aptamers were measured, followed by an evaluation of in vitro endonuclease inhibitory activity. Next, the antiviral effects of enriched aptamers against influenza A virus infections were examined. A total of three aptamers targeting PA and six aptamers targeting PAN were selected. Our data demonstrated that all three PA-selected aptamers neither inhibited endonuclease activity nor exhibited antiviral efficacy, whereas four of the six PAN-selected aptamers inhibited both endonuclease activity and H5N1 virus infection. Among the four effective aptamers, one exhibited cross-protection against infections of H1N1, H5N1, H7N7, and H7N9 influenza viruses, with a 50% inhibitory concentration (IC50) of around 10 nM. Notably, this aptamer was identified at the 5th round but disappeared after the 10th round of selection, suggesting that the identification and evaluation of aptamers at early rounds of selection may be highly helpful for screening effective aptamers. Overall, our study provides novel insights for screening and developing effective aptamers for use as anti-influenza drugs.
10.1128/AAC.00306-15
DNA aptamer-based rolling circle amplification product as a novel immunological adjuvant.
Al-Ogaili Adil S,Liyanage Rohana,Lay Jack O,Jiang Tieshan,Vuong Christine N,Agrawal Shilpi,Kumar Thallapuranam Krishnaswamy Suresh,Berghman Luc R,Hargis Billy M,Kwon Young Min
Scientific reports
Several agonists to CD40 have shown to induce acquired immune responses. Here, we developed and evaluated the rolling circle amplification (RCA) products that are based on anti-CD40 DNA aptamers as a novel vaccine adjuvant. First, we developed DNA aptamers with specific binding affinity to chicken CD40 extra domain (chCD40ED). Next, we prepared the RCA products that consist of these aptamers to increase the spanning space and overall binding affinity to chCD40ED. Using 8 DNA aptamer candidates, 4 aptamer-based RCA products (aptamer RCAs) were generated, each consisting of two distinct aptamers. We demonstrated that all 4 aptamer RCAs significantly induced the signal transduction in chicken HD11 macrophage cell line (p < 0.05). Finally, we conjugated one of the aptamer RCAs (Aptamer RCA II) to M2e epitope peptide of influenza virus as a model hapten, and the immune complex was injected to chickens. Aptamer RCA II stimulated anti-M2e IgG antibody production to the level significantly higher as compared to the control (M2e epitope alone; p < 0.05). The results of our work suggest that aptamer RCA is a novel platform to boost the efficacy of vaccines, which might find broad applications to other antigens beyond M2e epitope evaluated in this study using chicken infection model.
10.1038/s41598-020-79420-w
Selective counting and sizing of single virus particles using fluorescent aptamer-based nanoparticle tracking analysis.
Szakács Zoltán,Mészáros Tamás,de Jonge Marien I,Gyurcsányi Róbert E
Nanoscale
Detection and counting of single virus particles in liquid samples are largely limited to narrow size distribution of viruses and purified formulations. To address these limitations, here we propose a calibration-free method that enables concurrently the selective recognition, counting and sizing of virus particles as demonstrated through the detection of human respiratory syncytial virus (RSV), an enveloped virus with a broad size distribution, in throat swab samples. RSV viruses were selectively labeled through their attachment glycoproteins (G) with fluorescent aptamers, which further enabled their identification, sizing and counting at the single particle level by fluorescent nanoparticle tracking analysis. The proposed approach seems to be generally applicable to virus detection and quantification. Moreover, it could be successfully applied to detect single RSV particles in swab samples of diagnostic relevance. Since the selective recognition is associated with the sizing of each detected particle, this method enables to discriminate viral elements linked to the virus as well as various virus forms and associations.
10.1039/c8nr01310a
UCLA1 aptamer inhibition of human immunodeficiency virus type 1 subtype C primary isolates in macrophages and selection of resistance.
Mufhandu Hazel Tumelo,Alexandre Kabamba Bankoledi,Gray Elin Solomonovna,Morris Lynn,Khati Makobetsa
Biochemistry and biophysics reports
We have previously shown that the aptamer, UCLA1, is able to inhibit HIV-1 replication in peripheral blood mononuclear cells (PBMCs) by binding to residues in gp120. In this study we examined whether UCLA1 was effective against HIV-1 subtype C isolates in monocyte-derived macrophages (MDMs). Of 4 macrophage-tropic isolates tested, 3 were inhibited by UCLA1 in the low nanomolar range (IC<29 nM). One isolate that showed reduced susceptibility (<50 nM) to UCLA1 contained mutations in the α5 helix next to the CD4 and co-receptor (CoR) binding complex. To further evaluate aptamer resistance, two primary viruses were subjected to increasing concentrations of UCLA1 over a period of 84 days in PBMCs. One isolate showed a 7-fold increase in IC (351 nM) associated with genetic changes, some of which were previously implicated in resistance. This included F223Y in the C2 region and P369L within the CD4 and CoR binding complex. A second isolate showed a 3-fold increase in IC (118 nM) but failed to show any genetic changes. Collectively, these data show that UCLA1 can efficiently block HIV-1 infection in MDMs and PBMCs with escape mutations arising in some isolates after prolonged exposure to the aptamer. This supports the further development of the UCLA1 aptamer as a HIV-1 entry inhibitor.
10.1016/j.bbrep.2016.07.005
Rapid and sensitive detection of redspotted grouper nervous necrosis virus (RGNNV) infection by aptamer-coat protein-aptamer sandwich enzyme-linked apta-sorbent assay (ELASA).
Zhou L,Li P,Ni S,Yu Y,Yang M,Wei S,Qin Q
Journal of fish diseases
Redspotted grouper nervous necrosis virus (RGNNV) is one of the most devastating pathogens in the aquaculture of the grouper, Epinephlus sp., worldwide. The early and rapid diagnosis of RGNNV is important for the prevention of RGNNV infection. In this study, an aptamer (A10)-based sandwich enzyme-linked apta-sorbent assay (ELASA) was developed for RGNNV diagnosis. This sandwich ELASA showed high specificity for the RGNNV coat protein (CP) and virions in virus-infected cells and tissues. At the optimized working concentration of 200 nM of aptamer, the ELASA could detect RGNNV in the lysates of as few as 4 × 10 RGNNV-infected GB cells. Incubation for 10 min was sufficient to produce accurate results. The sandwich ELASA was most stable at incubation temperatures of 4-25°C, but could still distinguish RGNNV-infected samples from the controls at 37°C. It could detect RGNNV infection in brain lysates diluted 1/10, with results consistent with those of reverse transcription PCR, although with 10% less sensitivity. The main equipment required includes dissection tools, a water bath, Pierce™ Streptavidin Coated Plates and a microplate reader. The sandwich ELASA has great potential utility for the rapid and sensitive diagnosis of RGNNV in its early stages by fish farmers.
10.1111/jfd.12656
Development and characterization of Sindbis virus with encoded fluorescent RNA aptamer Spinach2 for imaging of replication and immune-mediated changes in intracellular viral RNA.
Nilaratanakul Voraphoj,Hauer Debra A,Griffin Diane E
The Journal of general virology
Viral RNA studies often rely on in situ hybridization and reverse transcriptase-PCR to provide snapshots of RNA dynamics in infected cells. To facilitate analysis of cellular RNAs, aptamers Spinach and Spinach2 that bind and activate the conditional fluorophore 3, 5-difluoro-4-hydroxybenzylidene imidazolinon have been developed. To determine the feasibility of applying this technology to viral RNA, we have used cDNA clones of the TE strain of Sindbis virus (SINV) to construct multiple viruses containing one or two copies of tRNA-scaffolded Spinach2 after a second subgenomic promoter, TEds-1Sp and TEds-2Sp within the 3'UTR, TE-1UTRSp, or after a second subgenomic promoter and in the 3'UTR, TEds-1Sp+1 UTRSp. TEds-1Sp+1 UTRSp gave the brightest signal and replicated well in cell culture, while TEds-2Sp was the dimmest and replicated poorly. Selection of baby hamster kidney cells infected with TEds-1Sp+1 UTRSp for improved signal intensity identified a virus with a stronger signal and point mutations in the tRNA scaffold. Imaging of SINV in BHK cells showed RNA to be concentrated in filopodia that contacted and transferred RNA to adjacent cells. The effect of treatment with anti-E2 antibody, which effects non-cytolytic clearance of SINV from neurons, on viral RNA was cell-type-dependent. In antibody-treated BHK cells, intracellular viral RNA increased and spread of infection continued. In undifferentiated and differentiated AP7 neuronal cells antibody treatment induced viral RNA clearance. Both viruses with two inserted aptamers were prone to deletion. These studies form the basis for further development of aptamer-labelled viral RNAs that will facilitate functional studies on the dynamics of infection and clearance.
10.1099/jgv.0.000755
Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.
Jalali Tahmineh,Salehi-Vaziri Mostafa,Pouriayevali Mohammad Hassan,Gargari Seyed Latif Mousavi
Scientific reports
Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N)GGGAGACAAGAATAAGCA). The K of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.
10.1038/s41598-021-91826-8
An RNA aptamer that specifically binds to the glycosylated hemagglutinin of avian influenza virus and suppresses viral infection in cells.
Kwon Hyun-Mi,Lee Kwang Hyun,Han Byung Woo,Han Mi Ra,Kim Dong Ho,Kim Dong-Eun
PloS one
The influenza virus surface glycoprotein hemagglutinin (HA) is responsible for viral attachment to sialic acid-containing host cell receptors and it facilitates the initial stage of viral infection. In the present study, we isolated an RNA aptamer specific to the glycosylated receptor-binding domain of the HA protein (gHA1) after 12 cycles of the systematic evolution of ligands by exponential enrichment procedure (SELEX), and we then investigated if the selected aptamer suppresses viral infection in host cells. Nitrocellulose filter binding and enzyme-linked immunosorbent assay (ELISA) experiments revealed that 1 RNA aptamer, HA12-16, bound specifically to the gHA1 protein. Cell viability assay showed that the HA12-16 RNA aptamer suppressed viral infection in host cells by enhancing cell viability. Immunofluorescence microscopic analysis further demonstrated that the HA12-16 RNA aptamer suppresses viral attachment to host cells by neutralizing the receptor-binding site of influenza virus HA. These results indicate that the isolated RNA aptamer can be developed as an antiviral reagent against influenza through appropriate therapeutic formulation.
10.1371/journal.pone.0097574
Accurate detection of Newcastle disease virus using proximity-dependent DNA aptamer ligation assays.
Marnissi Boutheina,Khalfaoui Khouloud,Ebai Tonge,Marques Souza de Oliveira Felipe,Ghram Abdeljelil,Kamali-Moghaddam Masood,Hmila Issam
FEBS open bio
Detecting viral antigens at low concentrations in field samples can be crucial for early veterinary diagnostics. Proximity ligation assays (PLAs) in both solution and solid-phase formats are widely used for high-performance protein detection in medical research. However, the affinity reagents used, which are mainly poly- and monoclonal antibodies, play an important role in the performance of PLAs. Here, we have established the first homogeneous and solid-phase proximity-dependent DNA aptamer ligation assays for rapid and accurate detection of Newcastle disease virus (NDV). NDV is detected by a pair of extended DNA aptamers that, upon binding in proximity to proteins on the envelope of the virus, are joined by enzymatic ligation to form a unique amplicon that can be sensitively detected using real-time PCR. The sensitivity, specificity, and reproducibility of the assays were validated using 40 farm samples. The results demonstrated that the developed homogeneous and solid-phase PLAs, which use NDV-selective DNA aptamers, are more sensitive than the sandwich enzymatic-linked aptamer assay (ELAA), and have a comparable sensitivity to real-time reverse transcription PCR (rRT-PCR) as the gold standard detection method. In addition, the solid-phase PLA was shown to have a greater dynamic range with improved lower limit of detection, upper- and lower limit of quantification, and minimal detectable dose as compared with those of ELAA and rRT-PCR. The specificity of PLA is shown to be concordant with rRT-PCR.
10.1002/2211-5463.13117
Designing of peptide aptamer targeting the receptor-binding domain of spike protein of SARS-CoV-2: an in silico study.
Molecular diversity
Short synthetic peptide molecules which bind to a specific target protein with a high affinity to exert its function are known as peptide aptamers. The high specificity of aptamers with small-molecule targets (metal ions, dyes and theophylline; ATP) is within 1 pM and 1 μM range, whereas with the proteins (thrombin, CD4 and antibodies) it is in the nanomolar range (which is equivalent to monoclonal antibodies). The recently identified coronavirus (SARS-CoV-2) genome encodes for various proteins, such as envelope, membrane, nucleocapsid, and spike protein. Among these, the protein necessary for the virus to enter inside the host cell is spike protein. The work focuses on designing peptide aptamer targeting the spike receptor-binding domain of SARS-CoV-2. The peptide aptamer has been designed by using bacterial Thioredoxin A as the scaffold protein and an 18-residue-long peptide. The tertiary structure of the peptide aptamer is modeled and docked to spike receptor-binding domain of SARS CoV2. Molecular dynamic simulation has been done to check the stability of the aptamer and receptor-binding domain complex. It was observed that the aptamer binds to spike receptor-binding domain of SARS-CoV-2 in a similar pattern as that of ACE2. The aptamer-receptor-binding domain complex was found to be stable in a 100 ns molecular dynamic simulation. The aptamer is also predicted to be non-antigenic, non-allergenic, non-hemolytic, non-inflammatory, water-soluble with high affinity toward ACE2 than serum albumin. Thus, peptide aptamer can be a novel approach for the therapeutic treatment for SARS-CoV-2.
10.1007/s11030-020-10171-6
In-Silico Selection of Aptamer Targeting SARS-CoV-2 Spike Protein.
International journal of molecular sciences
Aptamers are single-stranded, short DNA or RNA oligonucleotides that can specifically bind to various target molecules. To diagnose the infected cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in time, numerous conventional methods are applied for viral detection via the amplification and quantification of DNA or antibodies specific to antigens on the virus. Herein, we generated a large number of mutated aptamer sequences, derived from a known sequence of receptor-binding domain (RBD)-1C aptamer, specific to the RBD of SARS-CoV-2 spike protein (S protein). Structural similarity, molecular docking, and molecular dynamics (MD) were utilized to screen aptamers and characterize the detailed interactions between the selected aptamers and the S protein. We identified two mutated aptamers, namely, RBD-1CM1 and RBD-1CM2, which presented better docking results against the S protein compared with the RBD-1C aptamer. Through the MD simulation, we further confirmed that the RBD-1CM1 aptamer can form the most stable complex with the S protein based on the number of hydrogen bonds formed between the two biomolecules. Based on the experimental data of quartz crystal microbalance (QCM), the RBD-1CM1 aptamer could produce larger signals in mass change and exhibit an improved binding affinity to the S protein. Therefore, the RBD-1CM1 aptamer, which was selected from 1431 mutants, was the best potential candidate for the detection of SARS-CoV-2. The RBD-1CM1 aptamer can be an alternative biological element for the development of SARS-CoV-2 diagnostic testing.
10.3390/ijms23105810
A serum-stable RNA aptamer specific for SARS-CoV-2 neutralizes viral entry.
Proceedings of the National Academy of Sciences of the United States of America
The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic has created an urgent need for new technologies to treat COVID-19. Here we report a 2'-fluoro protected RNA aptamer that binds with high affinity to the receptor binding domain (RBD) of SARS-CoV-2 spike protein, thereby preventing its interaction with the host receptor ACE2. A trimerized version of the RNA aptamer matching the three RBDs in each spike complex enhances binding affinity down to the low picomolar range. Binding mode and specificity for the aptamer-spike interaction is supported by biolayer interferometry, single-molecule fluorescence microscopy, and flow-induced dispersion analysis in vitro. Cell culture experiments using virus-like particles and live SARS-CoV-2 show that the aptamer and, to a larger extent, the trimeric aptamer can efficiently block viral infection at low concentration. Finally, the aptamer maintains its high binding affinity to spike from other circulating SARS-CoV-2 strains, suggesting that it could find widespread use for the detection and treatment of SARS-CoV-2 and emerging variants.
10.1073/pnas.2112942118
Single-stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism.
Woo Hye-Min,Kim Ki-Sun,Lee Jin-Moo,Shim Hee-Sup,Cho Seong-Je,Lee Won-Kyu,Ko Hyuk Wan,Keum Young-Sam,Kim Soo-Youl,Pathinayake Prabuddha,Kim Chul-Joong,Jeong Yong-Joo
Antiviral research
Non-structural protein 1 (NS1) of the influenza A virus (IAV) inhibits the host's innate immune response by suppressing the induction of interferons (IFNs). Therefore, blocking NS1 activity can be a potential strategy in the development of antiviral agents against IAV infection. In the present study, we selected a single-stranded DNA aptamer specific to the IAV NS1 protein after 15 cycles of systematic evolution of ligands by exponential enrichment (SELEX) procedure and examined the ability of the selected aptamer to inhibit the function of NS1. The selected aptamer binds to NS1 with a Kd of 18.91±3.95nM and RNA binding domain of NS1 is determined to be critical for the aptamer binding. The aptamer has a G-rich sequence in the random sequence region and forms a G-quadruplex structure. The localization of the aptamer bound to NS1 in cells was determined by confocal images, and flow cytometry analysis further demonstrated that the selected aptamer binds specifically to NS1. In addition, luciferase reporter gene assay, quantitative RT-PCR, and enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that the selected aptamer had the ability to induce IFN-β by suppressing the function of NS1. Importantly, we also found that the selected aptamer was able to inhibit the viral replication without affecting cell viability. These results indicate that the selected ssDNA aptamer has strong potential to be further developed as a therapeutic agent against IAV.
10.1016/j.antiviral.2013.09.004
Aptamer Blocking Strategy Inhibits SARS-CoV-2 Virus Infection.
Angewandte Chemie (International ed. in English)
The COVID-19 pandemic caused by SARS-CoV-2 is threating global health. Inhibiting interaction of the receptor-binding domain of SARS-CoV-2 S protein (S ) and human ACE2 receptor is a promising treatment strategy. However, SARS-CoV-2 neutralizing antibodies are compromised by their risk of antibody-dependent enhancement (ADE) and unfavorably large size for intranasal delivery. To avoid these limitations, we demonstrated an aptamer blocking strategy by engineering aptamers' binding to the region on S that directly mediates ACE2 receptor engagement, leading to block SARS-CoV-2 infection. With aptamer selection against S and molecular docking, aptamer CoV2-6 was identified and applied to prevent, compete with, and substitute ACE2 from binding to S . CoV2-6 was further shortened and engineered as a circular bivalent aptamer CoV2-6C3 (cb-CoV2-6C3) to improve the stability, affinity, and inhibition efficacy. cb-CoV2-6C3 is stable in serum for more than 12 h and can be stored at room temperature for more than 14 days. Furthermore, cb-CoV2-6C3 binds to S with high affinity (K =0.13 nM) and blocks authentic SARS-CoV-2 virus with an IC of 0.42 nM.
10.1002/anie.202100225
Peptide Aptamer of Complementarity-determining Region to Detect Avian Influenza Virus.
Nguyen Anh Thi Viet,Trinh Tien Thi Thuy,Hoang Vui Thi,Dao Tung Duy,Tuong Hien Thi,Kim Hak Sung,Park Hyun,Yeo Seon-Ju
Journal of biomedical nanotechnology
Despite significant progress in the development of diagnostic methods for influenza, avian influenza (AI) infection continues to represent a substantial threat to human health. Among the subtypes of AI, H5 influenza is highly infectious to animals and humans; however, there are no reliable H5 subtype-specific diagnostic systems owing to a scarcity of H5 subtype-specific detection elements. In this study, a new peptide aptamer (P1:KASGYTFTSF) was developed to recognize the H5 viral subtype using an bioinformatics approach for predicting complementarity-determining regions (CDRs), and the aptamer was evaluated by immunoassays. The three-dimensional structure of influenza hemagglutinin (HA) and the peptide were used in a molecular docking study, and the peptide was compared to the epitope-derived peptide aptamer (H5-P2:KPNGAINF). Interactions between the peptides and the virus were then assessed by fluorescence-linked sandwich immunosorbent assay (FLISA), immunofluorescence staining assay (IFA), and rapid fluorescent immunochromatographic assay (FICT). P1 and H5-P2 both significantly detected H5N3 at 15.6 HAU/mL ( 0.05), and P1 detected the virus more effectively ( 0.05), consistent with the docking result. An optical image of the peptide recognizing an H5N3-infected cell was acquired by IFA, and was consistent with the antibody-linked IFA result. FICT employing the peptide showed the ability for H5 subtype-specific diagnosis, with 2-fold higher performance than that of a conventional, antibody-linked rapid test. This work shows the potential of a CDR-predicted peptide aptamer as a probe for immunological assays that can specifically recognize AI virus.
10.1166/jbn.2019.2772
Integrated microfluidic system for rapid detection of influenza H1N1 virus using a sandwich-based aptamer assay.
Tseng Yi-Ting,Wang Chih-Hung,Chang Chih-Peng,Lee Gwo-Bin
Biosensors & bioelectronics
The rapid spread of influenza-associated H1N1 viruses has caused serious concern in recent years. Therefore, there is an urgent need for the development of automatic, point-of-care devices for rapid diagnosis of the influenza virus. Conventional approaches suffer from several critical issues; notably, they are time-consuming, labor-intensive, and are characterized by relatively low sensitivity. In this work, we present a new approach for fluorescence-based detection of the influenza A H1N1 virus using a sandwich-based aptamer assay that is automatically performed on an integrated microfluidic system. The entire detection process was shortened to 30min using this chip-based system which is much faster than the conventional viral culture method. The limit of detection was significantly improved to 0.032 hemagglutination unit due to the high affinity and high specificity of the H1N1-specific aptamers. The results showed that the two-aptamer microfluidic system had about 10(3) times higher sensitivity than the conventional serological diagnosis. It was demonstrated that the developed microfluidic system may play as a powerful tool in the detection of the H1N1 virus.
10.1016/j.bios.2016.03.073
Development of a novel peptide aptamer-based immunoassay to detect Zika virus in serum and urine.
Kim Do Thi Hoang,Bao Duong Tuan,Park Hyun,Ngoc Nguyen Minh,Yeo Seon-Ju
Theranostics
Zika virus (ZIKV) has been identified as a cause of adverse outcomes of pregnancy, including microcephaly and other congenital diseases. Most people infected with ZIKV do not show any symptoms. Development of a method to discriminate dengue virus (DENV) and ZIKV infections has been challenging, and efficient assays for patient management are limited, attributable to high levels of cross-reactivity among co-circulating . Thus, there is an urgent need for a specific high-throughput diagnostic assay to discriminate ZIKV infections from other infections. A novel epitope peptide of the ZIKV envelope protein was predicted using three immune epitope database analysis tools and then further modified. A molecular docking study was conducted using three-dimensional structures of the ZIKV envelope and peptide. Experimentally, interactions between the selected peptides and virus were assessed via a fluorescence-linked sandwich immunosorbent assay (FLISA), and performance of peptide-linked sandwich FLISA was evaluated in virus-spiked human serum and urine. The Z_10.8 peptide (KRAVVSCAEA) was predicted to be a suitable detector, with a higher binding affinity than other candidates based on four criteria (binding affinity, root mean square deviation, position of amine residue of lysine at the N-terminus, and interactive site) in a docking study. Z_10.8 was significantly more efficient at detecting ZIKV than the other two peptides, as shown in the direct FLISA ( < 0.001). Further, the equilibrium dissociation constant (K) for the Z_10.8 peptide was 706.0 ± 177.9 (mean ± SD, nM), with specificity to discriminate ZIKV from DENV. The limit of detection for the sandwich FLISA was calculated as 1×10 tissue culture infective dose (TCID)/mL. The presence of serum or urine did not interfere with the performance of the Z_10.8-linked sandwich FLISA. Four criteria are suggested for the development of an modeled peptide aptamer; this computerized peptide aptamer discriminated ZIKV from DENV via immunoassay.
10.7150/thno.25955
Advances in detection of infectious agents by aptamer-based technologies.
Emerging microbes & infections
Infectious diseases still remain one of the biggest challenges for human health. Accurate and early detection of infectious pathogens are crucial for transmission control, clinical diagnosis, and therapy. For a traditional reason, most immunological and microbiological laboratories are equipped with instruments designated for antibody-based assays in detection of infectious pathogens or clinical diagnosis. Emerging aptamer-based technologies have pushed a shift from antibody-based to aptamer-based assays due to equal specificity, even better sensitivity, lower manufacturing cost and more flexibility in amending for chemiluminescent, electrochemical or fluorescent detection in a multifaceted and high throughput fashion in comparison of aptamer-based to antibody-based assays. The nature of aptamer-based technologies is particularly suitable for point-of-care testing in remote areas at warm or hot atmosphere, and mass screening for potential infection in pandemic of emerging infectious agents, such as SARS-CoV or SARS-CoV-2 in an epicentre or other regions. This review intends to summarize currently available aptamer-based technologies in detection of bacterial, viral, and protozoan pathogens for research and clinical application. It is anticipated that potential technologies will be further optimized and validated for clinical translation in meeting increasing demands for prompt, precise, and reliable detection of specific pathogens in various atmospheric conditions.
10.1080/22221751.2020.1792352
Development of a peptide aptamer pair-linked rapid fluorescent diagnostic system for Zika virus detection.
Nguyen Anh Thi Viet,Duong Bao Tuan,Park Hyun,Yeo Seon-Ju
Biosensors & bioelectronics
A rapid diagnostic system employing an antigen detection biosensing method is needed to discriminate between Zika virus (ZIKV) and Dengue virus (DENV) due to their close antigenic homology. We developed a novel peptide pair-based flow immunochromatographic test strip (FICT) assay to detect ZIKV. Peptide aptamers, P6.1 (KQERNNWPLTWT), P29.1 (KYTTSTLKSGV), and B2.33 (KRHVWVSLSYSCAEA) were designed by paratopes and modified against the ZIKV envelope protein based on the binding affinity. An antibody-free lateral FICT was developed using a pair of peptide aptamers. In the rapid diagnostic strip, the limit of detection (LOD) for the B2.33-P6.1 peptide pair for ZIKV was 2 × 10 tissue culture infective dose TCID/mL. Significantly, FICT could discriminate ZIKV from DENV. The stability and performance of FICT were confirmed using human sera and urine, showing a comparable LOD value. Our study demonstrated that in silico modeling could be used to develop a novel peptide pair-based FICT assay for detecting ZIKV by a rapid diagnostic test.
10.1016/j.bios.2021.113768
Specific delivering of RNAi using Spike's aptamer-functionalized lipid nanoparticles for targeting SARS-CoV-2: A strong anti-Covid drug in a clinical case study.
Chemical biology & drug design
Coronavirus (SARS-CoV-2) as a global pandemic has attracted the attention of many scientific centers to find the right treatment. We expressed and purified the recombinant receptor-binding domain (RBD) of the SARS-CoV-2 spike (S) protein, and specific RBD aptamers were designed using SELEX method. RNAi targeting nucleocapsid phosphoprotein was synthesized and human lung cells were inoculated with aptamer-functionalized lipid nanoparticles (LNPs) containing RNAi. The results demonstrated that RBD aptamer having K values of 0.290 nm possessed good affinity. Based on molecular docking and efficacy prediction analysis, siRNA molecule was showed the best action. LNPs were appropriately functionalized by aptamer and contained RNAi molecules. Antiviral assay using q-PCR and ELISA demonstrated that LNP functionalized with 35 µm Apt and containing 30 nm RNAi/ml of cell culture had the best antiviral activity compared to other concentrations. Applied aptamer in the nanocarrier has two important functions. First, it can deliver the drug (RNAi) to the surface of epithelial cells. Second, by binding to the SARS-CoV-2 spike protein, it inhibits the virus entrance into cells. Our data reveal an interaction between the aptamer and the virus, and RNAi targeted the virus RNA. CT scan and the clinical laboratory tests in a clinical case study, a 36-year old man who presented with severe SARS-CoV-2, demonstrated that inhalation of 10 mg Apt-LNPs-RNAi nebulized/day for six days resulted in an improvement in consolidation and ground-glass opacity in lungs on the sixth day of treatment. Our findings suggest the treatment of SARS-CoV-2 infection through inhalation of Aptamer-LNPs-RNAi.
10.1111/cbdd.13978
Developing all-in-one virus-like particles for Cas9 mRNA/single guide RNA co-delivery and aptamer-containing lentiviral vectors for improved gene expression.
International journal of biological macromolecules
Lentiviral vectors (LVs) are widely used for delivering foreign genes for long-term expression. Recently, virus-like particles (VLPs) were developed for mRNA or ribonucleoprotein (RNP) delivery for short-term endonuclease expression. Generating large amount of LVs or VLPs is challenging. On the other hand, methods for using VLPs to co-deliver Cas9 mRNA and single guide RNA (sgRNA) are limited. Fusing aptamer-binding protein (ABP) to the N-terminus of HIV Gag protein is currently the successful way to develop hybrid particles for co-delivering Cas9 mRNA and sgRNA. The effects of modifying Gag protein this way on particle assembly are unknown. Previously we found that adding an ABP after the second zinc finger domain of nucleocapsid (NC) protein had minimal effects on particle assembly. Based on these observations, here we developed hybrid particles for Cas9 mRNA and sgRNA co-delivery with normal capsid assembly efficiency. We further improved LVs for integrated gene expression by including an aptamer sequence in lentiviral genomic RNA, which improved lentiviral particle production and enhanced LV genomic RNA packaging. In summary, here we describe the development of new all-in-one VLPs for co-delivery of Cas9 mRNA and sgRNA, and new LVs for enhanced vector production and gene expression.
10.1016/j.ijbiomac.2022.04.114
Development of RNA aptamer that inhibits methyltransferase activity of dengue virus.
Jung Jae In,Han Seung Ryul,Lee Seong-Wook
Biotechnology letters
OBJECTIVES:To develop an RNA aptamer specific for the methyltransferase (MTase) of dengue virus (DENV) which is essential for viral genome replication and translation acting directly on N-7 and 2'-O-methylation of the type-I cap structure of the viral RNA. RESULTS:We identified 2'-fluoro-modified RNA aptamers that can specifically bind DENV serotype 2 (DENV2) MTase using systematic evolution of ligands by exponential enrichment technology. We truncated the chosen aptamer into a 45-mer RNA sequence that can bind DENV2 MTase with K ~ 28 nM and inhibit N-7 methylation activity of the protein. Moreover, the 45-mer truncated aptamer could not only bind with an K ~ 15.6 nM but also inhibit methylation activity of DENV serotype 3 (DENV3) MTase. The 45-mer aptamer competitively impeded binding of both DENV2 and DENV3 genomic RNA to MTase of each serotype. CONCLUSION:The selected 45-mer truncated RNA aptamer specifically and avidly bound DENV MTase and competitively inhibited its methylation activity, and thus could be useful for the development of anti-DENV agents.
10.1007/s10529-017-2462-7
Integrated microfluidic device using a single universal aptamer to detect multiple types of influenza viruses.
Wang Chih-Hung,Chang Chih-Peng,Lee Gwo-Bin
Biosensors & bioelectronics
DNA aptamers that can bind specific molecular targets have great potential as probes for microbial diagnostic applications. However, aptamers may change their conformation under different operating conditions, thus affecting their affinity and specificity towards the target molecules. In this study, a new integrated microfluidic system was developed that exploited the predictable change in conformation of a single universal influenza aptamer exposed to differing ion concentrations in order to detect multiple types of the influenza virus. Furthermore, the fluorescent-labeled universal aptamer used in this system could distinguish and detect three different influenza viruses (influenza A H1N1, H3N2, and influenza B) at the same time in 20min and therefore has great potential for point-of-care applications requiring rapid diagnosis of influenza viruses.
10.1016/j.bios.2016.06.071
Aptamer-targeting of Aleutian mink disease virus (AMDV) can be an effective strategy to inhibit virus replication.
Lu Taofeng,Zhang Hui,Zhou Jie,Ma Qin,Yan Wenzhuo,Zhao Lili,Wu Shuguang,Chen Hongyan
Scientific reports
Aleutian mink disease (AMD), which is caused by Aleutian mink disease virus (AMDV), is an important contagious disease for which no effective vaccine is yet available. AMD causes major economic losses for mink farmers globally and threatens some carnivores such as skunks, genets, foxes and raccoons. Aptamers have exciting potential for the diagnosis and/or treatment of infectious viral diseases, including AMD. Using a magnetic beads-based systemic evolution of ligands by exponential enrichment (SELEX) approach, we have developed aptamers with activity against AMDV after 10 rounds of selection. After incubation with the ADVa012 aptamer (4 μM) for 48 h, the concentration of AMDV in the supernatant of infected cells was 47% lower than in the supernatant of untreated cells, whereas a random library of aptamers has no effect. The half-life of ADVa012 was ~ 32 h, which is significantly longer than that of other aptamers. Sequences and three dimensions structural modeling of selected aptamers indicated that they fold into similar stem-loop structures, which may be a preferred structure for binding to the target protein. The ADVa012 aptamer was shown to have an effective and long-lasting inhibitory effect on viral production in vitro.
10.1038/s41598-021-84223-8
Aptamer Conjugated Gold Nanostar-Based Distance-Dependent Nanoparticle Surface Energy Transfer Spectroscopy for Ultrasensitive Detection and Inactivation of Corona Virus.
The journal of physical chemistry letters
The ongoing outbreak of the coronavirus infection has killed more than 2 million people. Herein, we demonstrate that Rhodamine 6G (Rh-6G) dye conjugated DNA aptamer-attached gold nanostar (GNS)-based distance-dependent nanoparticle surface energy transfer (NSET) spectroscopy has the capability of rapid diagnosis of specific SARS-CoV-2 spike recombinant antigen or SARS-CoV-2 spike protein pseudotyped baculovirus within 10 min. Because Rh-6G-attached single-stand DNA aptamer wrapped the GNS, 99% dye fluorescence was quenched because of the NSET process. In the presence of spike antigen or virus, the fluorescence signal persists because of the aptamer-spike protein binding. Specifically, the limit of detection for the NSET assay has been determined to be 130 fg/mL for antigen and 8 particles/mL for virus. Finally, we have demonstrated that DNA aptamer-attached GNSs can stop virus infection by blocking the angiotensin-converting enzyme 2 (ACE2) receptor binding capability and destroying the lipid membrane of the virus.
10.1021/acs.jpclett.0c03570
Rabies Prophylactic and Treatment Options: An In Vitro Study of siRNA- and Aptamer-Based Therapeutics.
Scott Terence Peter,Nel Louis Hendrik
Viruses
If the goal of eliminating dog-mediated human rabies by 2030 is to be achieved, effective mass dog vaccination needs to be complemented by effective prophylaxis for individuals exposed to rabies. Aptamers and short-interfering RNAs (siRNAs) have been successful in therapeutics, but few studies have investigated their potential as rabies therapeutics. In this study, siRNAs and aptamers-using a novel selection method-were developed and tested against rabies virus (RABV) in a post-infection (p.i.) scenario. Multiple means of delivery were tested for siRNAs, including the use of Lipofectamine and conjugation with the developed aptamers. One siRNA (N53) resulted in an 80.13% reduction in viral RNA, while aptamer UPRET 2.03 demonstrated a 61.3% reduction when used alone at 2 h p.i. At 24 h p.i., chimera UPRET 2.03-N8 (aptamer-siRNA) resulted in a 36.5% inhibition of viral replication. To our knowledge, this is the first study using siRNAs or aptamers that (1) demonstrated significant inhibition of RABV using an aptamer, (2) tested Lipofectamine RNAi-Max as a means for delivery, and (3) produced significant RABV inhibition at 24 h p.i. This study serves as a proof-of-concept to potentially use aptamers and siRNAs as rabies immunoglobulin (RIG) replacements or therapeutic options for RABV and provides strong evidence towards their further investigation.
10.3390/v13050881
Development of a Novel Lateral Flow Biosensor Combined With Aptamer-Based Isolation: Application for Rapid Detection of Grouper Nervous Necrosis Virus.
Frontiers in microbiology
Nervous necrosis virus (NNV) has infected more than 50 fish species worldwide, and has caused serious economic losses in the aquaculture industries. However, there is no effective antiviral therapy. The development of a rapid and accurate point-of-care diagnostic method for the prevention and control of NNV infection is urgently required. Commonly used methods for NNV detection include the cell culture-based assay, antibody-based assay and polymerase chain reaction (PCR)-based assay. However, these methods have disadvantages as they are time-consuming and complex. In the present study, we developed a simple and sensitive aptamer-based lateral flow biosensor (LFB) method for the rapid detection of red-spotted grouper nervous necrosis virus (RGNNV). An aptamer is a single-stranded nucleotide, which can specifically bind to the target and has many advantages. Based on a previously selected aptamer, which specifically bound to the coat protein of RGNNV (RGNNV-CP), two modified aptamers were used in this study. One aptamer was used for magnetic bead enrichment and the other was used for isothermal strand displacement amplification (SDA). After amplification, the product was further tested by the LFB, and the detection results were observed by the naked eye within 5 min with high specificity and sensitivity. The LFB method could detect RGNNV-CP protein as low as 5 ng/mL or 5 × 10 RGNNV-infected GB (grouper brain) cells. Overall, it is the first application of a LFB combined with aptamer in the rapid diagnosis of virus from aquatic animals, which provides a new option for virus detection in aquaculture.
10.3389/fmicb.2020.00886
Generation of Nucleic Acid Aptamer Candidates against a Novel Calicivirus Protein Target.
Faircloth Jeremy,Moore Matthew D,Stoufer Sloane,Kim Minji,Jaykus Lee-Ann
Viruses
Human norovirus is the leading cause of foodborne illness globally. One of the challenges in detecting noroviruses is the identification of a completely broadly reactive ligand; however, all detection ligands generated to date target the viral capsid, the outermost of which is the most variable region of the genome. The VPg is a protein covalently linked to the viral genome that is necessary for replication but hitherto remains underexplored as a target for detection or therapeutics. The purpose of this work was to generate nucleic acid aptamers against human norovirus (Norwalk) and cultivable surrogate (Tulane) VPgs for future use in detection and therapeutics. Eight rounds of positive-SELEX and two rounds of counter-SELEX were performed. Five and eight unique aptamer sequences were identified for Norwalk and Tulane VPg, respectively, all of which were predicted to be stable (∆G < -5.0) and one of which occurred in both pools. All candidates displayed binding to both Tulane and Norwalk VPg (positive:negative > 5.0), and all but two of the candidates displayed very strong binding (positive:negative > 10.0), significantly higher than binding to the negative control protein ( < 0.05). Overall, this work reports a number of aptamer candidates found to be broadly reactive and specific for in vitro-expressed VPgs across genus that could be used for future application in detection or therapeutics. Future work characterizing binding of the aptamer candidates against native VPgs and in therapeutic applications is needed to further evaluate their application.
10.3390/v13091716
The Functional Role of Loops and Flanking Sequences of G-Quadruplex Aptamer to the Hemagglutinin of Influenza a Virus.
International journal of molecular sciences
Nucleic acid aptamers are generally accepted as promising elements for the specific and high-affinity binding of various biomolecules. It has been shown for a number of aptamers that the complexes with several related proteins may possess a similar affinity. An outstanding example is the G-quadruplex DNA aptamer RHA0385, which binds to the hemagglutinins of various influenza A virus strains. These hemagglutinins have homologous tertiary structures but moderate-to-low amino acid sequence identities. Here, the experiment was inverted, targeting the same protein using a set of related, parallel G-quadruplexes. The 5'- and 3'-flanking sequences of RHA0385 were truncated to yield parallel G-quadruplex with three propeller loops that were 7, 1, and 1 nucleotides in length. Next, a set of minimal, parallel G-quadruplexes with three single-nucleotide loops was tested. These G-quadruplexes were characterized both structurally and functionally. All parallel G-quadruplexes had affinities for both recombinant hemagglutinin and influenza virions. In summary, the parallel G-quadruplex represents a minimal core structure with functional activity that binds influenza A hemagglutinin. The flanking sequences and loops represent additional features that can be used to modulate the affinity. Thus, the RHA0385-hemagglutinin complex serves as an excellent example of the hypothesis of a core structure that is decorated with additional recognizing elements capable of improving the binding properties of the aptamer.
10.3390/ijms22052409
Aptamer-Based Field-Effect Transistor for Detection of Avian Influenza Virus in Chicken Serum.
Kwon Jae,Lee Yeonju,Lee Taek,Ahn Jae-Hyuk
Analytical chemistry
Early diagnosis of the highly pathogenic H5N1 avian influenza virus (AIV) is significant for preventing and controlling a global pandemic. However, there is no existing electrical biosensor for detecting biomarkers for AIV in clinically relevant samples such as chicken serum. Herein, we report the first use of an aptamer-functionalized field-effect transistor (FET) as a label-free sensor for AIV detection in chicken serum. A DNA aptamer is employed as a sensitive and selective receptor for hemagglutinin (HA) protein, which is a biomarker for AIVs. This aptamer is immobilized on a gold microelectrode that is connected to the gate of a reusable FET transducer. The specific binding of the target protein results in a change in the surface potential, which generates a signal response of the FET transducer. We hypothesize that a conformational change in the DNA aptamer upon specific binding of HA protein may alter the surface potential. The signal of the aptamer-based FET biosensor increased linearly with the increase in the logarithm of HA protein concentration in a dynamic range of 10 pM to 10 nM with a detection limit of 5.9 pM. The selectivity of the biosensor for HA protein was confirmed by employing relevant interfering proteins. The proposed biosensor was successfully applied to the selective detection of HA protein in a chicken serum sample. Owing to its simple and low-cost architecture, portability, and sensitivity, the aptamer-based FET biosensor has potential as a point-of-care diagnosis of H5N1 AIVs in clinical samples.
10.1021/acs.analchem.0c00348
Aptamer selection and application in multivalent binding-based electrical impedance detection of inactivated H1N1 virus.
Bai Chenjun,Lu Zhangwei,Jiang Hua,Yang Zihua,Liu Xuemei,Ding Hongmei,Li Hui,Dong Jie,Huang Aixue,Fang Tao,Jiang Yongqiang,Zhu Lingling,Lou Xinhui,Li Shaohua,Shao Ningsheng
Biosensors & bioelectronics
The type A influenza viruses are the most virulent and variable human pathogens with epidemic or even pandemic threat. The development of sensitive, specific and safe field testing methods is in particular need and quite challenging. We report here the selection and practical utilization of the inactivated influenza virus-specific aptamers. The DNA aptamers against inactivated intact H1N1 virus particles were identified through the systematic evolution of ligands by exponential enrichment (SELEX) procedure. The discriminative aptamers and their truncated sequences showed selectively high affinity to inactive H1N1 virus and H3N2 virus with the K in the low nanomolar range and collective binding properties. The truncated sequences were first applied in a sandwich enzyme-linked oligonucleotide assay (ELONA) with a H1N1 detection limit (LOD, S/N = 3) of 0.3 ng/μL and then in an electrochemical impedance (EIS) aptasensor with more than 300 times improved LOD (0.9 pg/μL) and the excellent selectivity over other viruses (> 100 times). Therefore the developed aptasensors represent the safer, simpler, and possibly better virus-variation adaptable means of virus diagnostics.
10.1016/j.bios.2018.03.047
Aptamer-Antibody Complementation On Multiwalled Carbon Nanotube-Gold Transduced Dielectrode Surfaces To Detect Pandemic Swine Influenza Virus.
International journal of nanomedicine
BACKGROUND:A pandemic influenza viral strain, influenza A/California/07/2009 (pdmH1N1), has been considered to be a potential issue that needs to be controlled to avoid the seasonal emergence of mutated strains. MATERIALS AND METHODS:In this study, aptamer-antibody complementation was implemented on a multiwalled carbon nanotube-gold conjugated sensing surface with a dielectrode to detect pandemic pdmH1N1. Preliminary biomolecular and dielectrode surface analyses were performed by molecular and microscopic methods. A stable anti-pdmH1N1 aptamer sequence interacted with hemagglutinin (HA) and was compared with the antibody interaction. Both aptamer and antibody attachments on the surface as the basic molecule attained the saturation at nanomolar levels. RESULTS:Aptamers were found to have higher affinity and electric response than antibodies against HA of pdmH1N1. Linear regression with aptamer-HA interaction displays sensitivity in the range of 10 fM, whereas antibody-HA interaction shows a 100-fold lower level (1 pM). When sandwich-based detection of aptamer-HA-antibody and antibody-HA-aptamer was performed, a higher response of current was observed in both cases. Moreover, the detection strategy with aptamer clearly discriminated the closely related HA of influenza B/Tokyo/53/99 and influenza A/Panama/2007/1999 (H3N2). CONCLUSION:The high performance of the abovementioned detection methods was supported by the apparent specificity and reproducibility by the demonstrated sensing system.
10.2147/IJN.S219976
Inhibition of Japanese encephalitis virus (JEV) replication by specific RNA aptamer against JEV methyltransferase.
Han Seung Ryul,Lee Seong-Wook
Biochemical and biophysical research communications
Japanese encephalitis virus (JEV) is the most common etiological agent of epidemic viral encephalitis. JEV encodes a single methyltransferase (MTase) domain located at the N-terminal region of the viral nonstructural protein NS5. JEV MTase is essential for viral replication and specifically catalyzes methylation of the viral RNA cap, which occurs exclusively in the cytoplasm. Therefore, JEV MTase is a potential target for antiviral therapy. Here, we identified specific and avid RNA aptamer (K ∼ 12 nM) with modified 2'-O-methyl pyrimidines against JEV MTase. The RNA aptamer efficiently inhibited viral cap methylation activity of MTase and interfered with JEV production in cells. Moreover, we generated a 24-mer truncated aptamer that could specifically bind to JEV MTase with high affinity (K ∼16 nM). The 24-mer aptamer efficiently inhibited JEV production and replication in cells. Therefore, MTase-specific RNA aptamer might be useful as an anti-JEV agent.
10.1016/j.bbrc.2016.12.081
The research of aptamer biosensor technologies for detection of microorganism.
Yi Jiecan,Xiao Wen,Li Guiyin,Wu Pian,He Yayuan,Chen Cuimei,He Yafei,Ding Ping,Kai Tianhan
Applied microbiology and biotechnology
The activities and transmissions of microorganisms are closely related to human, and all kinds of diseases caused by pathogenic microorganisms have attracted attention in the world and brought many challenges to human health and public health. The traditional microbial detection technologies have characteristics of longer detection cycle and complicated processes, therefore, which can no longer meet the detection requirements in the field of public health. At present, it is the focus to develop and design a novel, rapid, and simple microbial detection method in the field of public health. Herein, this article summarized the development of aptamer biosensor technologies for detection of microorganism in the aspect of bacteria, viruses, and toxins in detail, including optical aptamer sensors such as fluorometry and colorimetry, electrochemical aptamer sensors, and other technologies combined with aptamer. KEY POINTS: • Aptamer biosensor is a good platform for microbial detection. • Aptamer biosensors include optical sensors and electrochemical sensors. • Aptamer sensors have been widely used in the detection of bacteria, viruses, and other microorganisms.
10.1007/s00253-020-10940-1
Advancement of dengue virus NS1 protein detection by 3D-nanoassembly complex gold nanoparticles utilizing competitive sandwich aptamer on disposable electrode.
Analytica chimica acta
Signal amplification have been centralized in developing the highly reliable biosensor for analyte detection with a narrow detection window. We proposed an aptasensor to provide a highly sensitive early-stage diagnostic platform of dengue virus NS1 protein (DENV-NS1) by dual-approach - colorimetric and electrochemical detection. This work utilized two different aptamers specific to DENV-NS1: One conjugated to gold nanoparticles (AuNPs), forming AuNPs-Apt and its complementary sequence aptamer, forming AuNPs-Apt. The unbound Apt of AuNPs-Apt by DENV-NS1 were to hybridize to AuNPs-Apt and induced a 3D-nanoassembled formation, resulting in DENV-NS1 concentration-dependent plasmonic color change. Occurrence of the hybridization of Apt and Apt, the 3D-assembled hybridized aptamers of AuNPs was incubated with methylene blue (MB) solution, which intercalated a high number of MB molecules within the duplex structure of aptamers, and the complex was captured on the Apt-conjugated disposable gold electrode (DGE). The developed aptamer-based biosensor showed high sensitivity with colorimetric response down to 1.28 pg/mL and electrochemical approach down to 30 fg/mL of DENV-NS1 with good selectivity. This work showcases an advanced utilization of aptamer and its complementary anti-sense aptamer in signal amplification and nanocarrier for biosensing.
10.1016/j.aca.2022.339817
A novel method for detection of H9N2 influenza viruses by an aptamer-real time-PCR.
Hmila Issam,Wongphatcharachai Manoosak,Laamiri Nacira,Aouini Rim,Marnissi Boutheina,Arbi Marwa,Sreevatsan Srinand,Ghram Abdeljelil
Journal of virological methods
H9N2 Influenza subtype has emerged in Tunisia causing epidemics in poultry and resulting in major economic losses. New mutations in their hemagglutinin and neuraminidase proteins were acquired, suggesting their potential to directly infect humans. Effective surveillance tools should be implemented to help prevent potential spillover of the virus across species. We have developed a highly sensitive real time immuno-polymerase chain reaction (RT-I-PCR) method for detecting H9N2 virus. The assay applies aptamers as ligands to capture and detect the virus. First, a panel of specific ssDNA aptamers was selected via a one step high stringency protocol. Next, the panel of selected aptamers was characterized for their affinities and their specificity to H9N2 virus. The aptamer showing the highest binding affinity to the virus was used as ligand to develop a highly sensitive sandwich Aptamer I-PCR. A 3-log increase in analytical sensitivity was achieved as compared to a routinely used ELISA antigen test, highlighting the potential of this approach to detect very low levels of virus particles. The test was validated using clinical samples and constitutes a rapid and a label-free platform, opening a new venue for the development of aptamer -based viability sensing for a variety of microorganisms of economic importance in Tunisia and surrounding regions.
10.1016/j.jviromet.2017.01.024
Enhancing erythrocyte-influenza virus specificity by glycan-conjugated gold nanoparticle: Validation of hemagglutination by aptamer and neuraminidases.
Ye Meiyi,Lin Lei,Yang Wei,Gopinath Subash C B
Biotechnology and applied biochemistry
This study demonstrated the terminated sialo-sugar chains (Neu5Acα2,6Gal and Neu5Acα2,3Gal)-mediated specificity enhancement of influenza virus and chicken red blood cell (RBC) by hemagglutination assay. These glycan chains were immobilized on the gold nanoparticle (GNP) to withhold the higher numbers. With the preliminary optimization, a clear button formation with 0.5% RBC was visualized. On the other hand, intact B/Tokio/53/99 with 750 nM hemagglutinin (HA) displayed a nice hemagglutination. The interference on the specificity of RBC and influenza virus was observed by anti-influenza aptamer at the concentration 31 nM; however, there is no hemagglutination prevention was noticed in the presence of complementary aptamer sequences. Spiking GNP-conjugated Neu5Acα2,6Gal or Neu5Acα2,3Gal or a mixture of these two to the reaction promoted the hemagglutination to 63-folds higher with 12 nM virus, whereas under the same condition the heat-inactivated viruses were lost the hemagglutination. Neuraminidases from Clostridium perfringens and Arthrobacter ureafaciens at 0.0025 neuraminidase units are able to abolish the hemagglutination. Other enzymes, Glycopeptidase F (Elizabethkingia meningoseptica) and Endoglycosidase H (Streptomyces plicatus) did not show the changes with agglutination. Obviously, sialyl-Gal-terminated glycan-conjugated GNP amendment has enhanced the specificity of erythrocyte-influenza virus and able to be controlled by aptamer or neuraminidases.
10.1002/bab.2152
Subtyping of influenza A H1N1 virus using a label-free electrochemical biosensor based on the DNA aptamer targeting the stem region of HA protein.
Bhardwaj Jyoti,Chaudhary Narendra,Kim Hajin,Jang Jaesung
Analytica chimica acta
Rapid subtyping of influenza viruses in clinical laboratories has been increasingly important because three subtypes (seasonal H1N1, H3N2, and 2009 H1N1) of influenza A virus currently disseminated in humans have variable susceptibilities to antiviral drug. Herein, we present DNA aptamers for selective detection of influenza A H1N1 (seasonal and 2009 pandemic H1N1) viruses by targeting recombinant influenza A mini-hemagglutinin (mini-HA) protein (the stable stem region of HA) and whole H1N1 viruses. The dissociation constants (K) of aptamer candidates V46 and V57 were 19.2 nM and 29.6 nM, respectively, according to electrochemical characterization (differential pulse voltammetry), demonstrating strong binding to mini-HA. In comparison, the K of the influenza virus antibodies is in the range of 1 μM-10 nM. Aptamer V46 showed higher specificity and binding affinity to the mini-HA protein and H1N1 subtypes, and it was also incorporated into an indium tin oxide-based electrochemical sensor, showing sensitive and specific detection of H1N1 viruses, with a limit of detection (LOD) of 3.7 plaque-forming units per mL. The binding affinity, specificity, and LOD achieved with the electrochemical sensor suggest that it can be used for rapid subtyping of H1N1. We also propose that this aptamer can be used for the neutralization of H1N1 subtypes, suggesting potential therapeutic and diagnostic applications.
10.1016/j.aca.2019.03.005
An aptamer that binds efficiently to the hemagglutinins of highly pathogenic avian influenza viruses (H5N1 and H7N7) and inhibits hemagglutinin-glycan interactions.
Suenaga Emi,Kumar Penmetcha K R
Acta biomaterialia
Highly pathogenic avian influenza (HPAI) H5 and H7 viruses have ravaged the poultry industry in numerous countries in Asia, Europe, Africa and the Middle East, and have resulted in the deaths of millions of birds. Although HPAI H5N1 viruses currently remain avian viruses, they are continuously evolving and have the potential to become pandemic-type viruses capable of human-human transmission. To develop specific reagents to allow better preparedness against this threat, we selected an aptamer (8-3) from a completely random RNA pool that binds with high affinity (∼ KD 170pM) to the hemagglutinins (HAs) derived from HPAI H5N1 (A/H5N1/Vietnam/1194/2004 and A/H5N1/Indonesia/05/2005) and H7N7 (A/H7N7/Netherlands/219/2003) influenza A viruses. Aptamer 8-3 was able to efficiently distinguish HAs derived from subtypes of influenza A virus other than H5 and H7. Aptamer 8-3 was analyzed further to assess its ability to interfere with HA-glycan interactions using our previously established SPR-based competitive assay, and we found that aptamer 8-3 efficiently interferes with HA-glycan binding (EC50 ∼ 25 nM). To derive shorter variants for other applications, aptamer 8-3 was shortened to a 44-mer by deletion analyses. The shortened aptamer, 8-3S, retains the full-length aptamer's affinity and specificity for its cognate Has, and also interferes with HA-glycan interactions. These studies suggest that aptamer 8-3S should be studied further to explore its potential applications not only in surveillance and diagnosis, but also in the development of H5N1- and H7N7-specific virucidal products that interfere with virus-host interactions to contain future H5N1 and H7N7 pandemics.
10.1016/j.actbio.2013.12.034
An Aptamer-Based Electrochemical Sensor That Can Distinguish Influenza Virus Subtype H1 from H5.
Lee Jin-Moo,Kim JunWon,Ryu Ilhwan,Woo Hye-Min,Lee Tae Gyun,Jung Woong,Yim Sanggyu,Jeong Yong-Joo
Journal of microbiology and biotechnology
The surface protein hemagglutinin (HA) mediates the attachment of influenza virus to host cells containing sialic acid and thus facilitates viral infection. Therefore, HA is considered as a good target for the development of diagnostic tools for influenza virus. Previously, we reported the isolation of single-stranded aptamers that can distinguish influenza subtype H1 from H5. In this study, we describe a method for the selective electrical detection of H1 using the isolated aptamer as a molecular probe. After immobilization of the aptamer on Si wafer, enzyme-linked immunosorbent assay (ELISA) and field emission scanning electron microscopy (FE-SEM) showed that the immobilized aptamer bound specifically to the H1 subtype but not to the H5 subtype. Assessment by cyclic voltammetry (CV) also demonstrated that the immobilized aptamer on the indium thin oxide-coated surface was specifically bound to the H1 subtype only, which was consistent with the ELISA and FE-SEM results. Further measurement of CV using various amounts of H1 subtype provided the detection limit of the immobilized aptamer, which showed that a nanomolar scale of target protein was sufficient to produce the signal. These results indicated that the selected aptamer can be an effective probe for distinguishing the subtypes of influenza viruses by monitoring current changes.
10.4014/jmb.1708.08015
Aptamer Profiling of A549 Cells Infected with Low-Pathogenicity and High-Pathogenicity Influenza Viruses.
Coombs Kevin M,Simon Philippe F,McLeish Nigel J,Zahedi-Amiri Ali,Kobasa Darwyn
Viruses
Influenza A viruses (IAVs) are important animal and human emerging and re-emerging pathogens that are responsible for yearly seasonal epidemics and sporadic pandemics. IAVs cause a wide range of clinical illnesses, from relatively mild infections by seasonal strains, to acute respiratory distress during infections with highly pathogenic avian IAVs (HPAI). For this study, we infected A549 human lung cells with lab prototype A/PR/8/34 (H1N1) (PR8), a seasonal H1N1 (RV733), the 2009 pandemic H1N1 (pdm09), or with two avian strains, an H5N1 HPAI strain or an H7N9 strain that has low pathogenicity in birds but high pathogenicity in humans. We used a newly-developed aptamer-based multiplexed technique (SOMAscan) to examine >1300 human lung cell proteins affected by the different IAV strains, and identified more than 500 significantly dysregulated cellular proteins. Our analyses indicated that the avian strains induced more profound changes in the A549 global proteome compared to all tested low-pathogenicity H1N1 strains. The PR8 strain induced a general activation, primarily by upregulating many immune molecules, the seasonal RV733 and pdm09 strains had minimal effect upon assayed molecules, and the avian strains induced significant downregulation, primarily in antimicrobial response, cardiovascular and post-translational modification systems.
10.3390/v11111028
High bio-recognizing aptamer designing and optimization against human herpes virus-5.
Kumar Neeraj,Sood Damini,Singh Snigdha,Kumar Suveen,Chandra Ramesh
European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences
While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5'CTCGCTTACCCCTGGGTGTGCGGG3') which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 Å through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. Inaddition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.
10.1016/j.ejps.2020.105572
A Novel Sandwich ELASA Based on Aptamer for Detection of Largemouth Bass Virus (LMBV).
Viruses
Largemouth bass virus (LMBV) is a major viral pathogen in largemouth bass culture, usually causing high mortality and heavy economic losses. Accurate and early detection of LMBV is crucial for diagnosis and control of the diseases caused by LMBV. Previously, we selected the specific aptamers, LA38 and LA13, targeting LMBV by systematic evolution of ligands by exponential enrichment (SELEX). In this study, we further generated truncated LA38 and LA13 (named as LA38s and LA13s) with high specificity and affinities and developed an aptamer-based sandwich enzyme-linked apta-sorbent assay (ELASA) for LMBV diagnosis. The sandwich ELASA showed high specificity and sensitivity for the LMBV detection, without cross reaction with other viruses. The detection limit of the ELASA was as low as 1.25 × 10 LMBV-infected cells, and the incubation time of the lysate and biotin labeled aptamer was as short as 10 min. The ELASA could still detect LMBV infection in spleen lysates at dilutions of 1/25, with good consistency of qRT-PCR. For the fish samples collected from the field, the sensitivity of ELASA was 13.3% less than PCR, but the ELASA was much more convenient and less time consuming. The procedure of ELASA mainly requires washing and incubation, with completion in approximately 4 h. The sandwich ELASA offers a useful tool to rapidly detect LMBV rapidly, contributing to control and prevention of LMBV infection.
10.3390/v14050945